Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10183
Trapped Gene
Ikbkap (ENSMUSG00000028431)
Vector Insertion
Chr 4: 56813010 - 56815030
Public Clones Ex381 (baygenomics)
Private Clones OST353706 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000349138 (Chr4:56815031..56815169 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCTTCAGTGGATCGTGTTT Chr4:56815112..56815131 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000349138 (Chr4:56815031..56815169 -)
Downstram Exon
ENSMUSE00000328270 (Chr4:56812847..56813009 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCTTCAGTGGATCGTGTTT Chr4:56815112..56815131 59.97 50 GGTCCGATGCAACTTCAGAT Chr4:56812948..56812967 60.08 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000349138 Chr4:56815031..56815169 CCCTTCAGTGGATCGTGTTT Chr4:56815112..56815131 59.97 50

*** Putative Vector Insertion (Chr 4: 56813010 - 56815030) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000328270 Chr4:56812847..56813009 GGTCCGATGCAACTTCAGAT Chr4:56812948..56812967 60.08 50
downstream ENSMUSE00000328262 Chr4:56811530..56811682 AAGAAAACCTTCTGCCACCA Chr4:56811622..56811641 59.71 45
downstream ENSMUSE00000328253 Chr4:56809376..56809457 CAGAGATACCACTGGCCACA Chr4:56809399..56809418 59.7 55
downstream ENSMUSE00000179097 Chr4:56808378..56808458 TCCTCTGCGATCACTTCAAA Chr4:56808385..56808404 59.52 45
downstream ENSMUSE00000179091 Chr4:56806962..56807047 TTACTGCCCCATCCAACAGT Chr4:56806995..56807014 60.38 50
downstream ENSMUSE00000179083 Chr4:56805257..56805353 CAGCAAAATACTGCCCATCC Chr4:56805259..56805278 60.47 50
downstream ENSMUSE00000179099 Chr4:56804899..56804989 GGCAAACTCTCGGTTCCATA Chr4:56804930..56804949 60.07 50
downstream ENSMUSE00000179078 Chr4:56803760..56803883 CACAACATCTTGCTGGTTGG Chr4:56803804..56803823 60.15 50
downstream ENSMUSE00000179069 Chr4:56803003..56803096 TAGCAAGCACCGAGGAATCT Chr4:56803032..56803051 59.98 50
downstream ENSMUSE00000179059 Chr4:56800613..56800843 CCAGCCCGTACAGAGAACAT Chr4:56800682..56800701 60.13 55
downstream ENSMUSE00000328203 Chr4:56799460..56799624 ATCTGGTTACTGGCGTCGAG Chr4:56799455..56799474 60.28 55
downstream ENSMUSE00000179073 Chr4:56797410..56797509 CCACGGCTCCTAGTTTCACT Chr4:56797443..56797462 59.35 55
downstream ENSMUSE00000328193 Chr4:56793898..56794089 GCCAGGAAAGTGTCGTCTTC Chr4:56793972..56793991 59.85 55
downstream ENSMUSE00000179077 Chr4:56792529..56792635 GCAGCATAAACCAATGACGA Chr4:56792571..56792590 59.69 45
downstream ENSMUSE00000179113 Chr4:56791831..56791934 CCAATCGTGGCTACTTCCAT Chr4:56791816..56791835 59.96 50
downstream ENSMUSE00000179071 Chr4:56789757..56789810 AAAGCGACACCTGTCAGTCA Chr4:56789753..56789772 59.47 50
downstream ENSMUSE00000179081 Chr4:56789562..56789667 GAGGCACCACTTAGGGAGAA Chr4:56789548..56789567 59.28 55
downstream ENSMUSE00000179057 Chr4:56788297..56788412 TTCCGCAGAATTTCTCCACT Chr4:56788336..56788355 59.81 45
downstream ENSMUSE00000179105 Chr4:56787889..56787962 ACTTCCGAATCTGTGCCAAG Chr4:56787877..56787896 60.26 50
downstream ENSMUSE00000179062 Chr4:56787560..56787638 GGGGTTATGGTCATGAATCAG Chr4:56787541..56787561 59.12 47.62
downstream ENSMUSE00000179101 Chr4:56787394..56787473 No primer for this exon
downstream ENSMUSE00000179095 Chr4:56786071..56786208 GTAATCGGGGGAGGGTACAT Chr4:56786145..56786164 59.9 55
downstream ENSMUSE00000179060 Chr4:56785888..56785973 CTTCTGCAGCACAATTTCCA Chr4:56785882..56785901 59.99 45
downstream ENSMUSE00000179089 Chr4:56785253..56785401 TCATAGGTCCCAAGGGAGTG Chr4:56785271..56785290 59.92 55
downstream ENSMUSE00000179087 Chr4:56784305..56784428 ACACTTGCTGAGGTGTCCAA Chr4:56784284..56784303 59.31 50
downstream ENSMUSE00000179075 Chr4:56783853..56783950 CTGTGGTGAGTCTGGACGAT Chr4:56783837..56783856 58.67 55
downstream ENSMUSE00000179080 Chr4:56781886..56782087 GTACAGGTGCTCCTGCATCA Chr4:56782018..56782037 59.86 55
downstream ENSMUSE00000179093 Chr4:56780687..56780748 TCACTGTGCTTCCTCTGCTC Chr4:56780696..56780715 59.29 55
downstream ENSMUSE00000179067 Chr4:56775713..56775775 TTCCCAGGCAGATCCTTCTA Chr4:56775706..56775725 59.77 50
downstream ENSMUSE00000179108 Chr4:56775121..56775181 TGGAAGGCTTTACACTGGTTT Chr4:56775108..56775128 58.75 42.86
downstream ENSMUSE00000179103 Chr4:56772673..56772786 CACCTGCAAGCGGTTTTTAT Chr4:56772691..56772710 60.13 45
downstream ENSMUSE00000179109 Chr4:56771836..56771947 CTGCTGGTTTCCGAGAAGAG Chr4:56771874..56771893 60.13 55
downstream ENSMUSE00000179079 Chr4:56771085..56771212 CCGACGGTTTTTAGATGACC Chr4:56771169..56771188 59.43 50
downstream ENSMUSE00000179070 Chr4:56769989..56770143 TCAAAATAGCACGCACCTCA Chr4:56770101..56770120 60.4 45
downstream ENSMUSE00000179074 Chr4:56768176..56768251 TGATGCTATTCGCAGTGGAG Chr4:56768196..56768215 59.97 50
downstream ENSMUSE00000328064 Chr4:56763646..56764591 GCACGAAGAGTGAGTGGACA Chr4:56764446..56764465 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr4:56814959..56814979 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTGCGTGACTGGGAAAACC Chr4:56814963..56814983 62.9 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028431