Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10193
Trapped Gene
Herpud2 (ENSMUSG00000008429)
Vector Insertion
Chr 9: 24935097 - 24937641
Public Clones DTM043 (baygenomics)
Private Clones OST415700 (lexicon)
Severity of mutation (?) Insertion after 18% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000215247 (Chr9:24937642..24937719 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000215247 (Chr9:24937642..24937719 -)
Downstram Exon
ENSMUSE00000215245 (Chr9:24934983..24935096 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000334820 Chr9:24955319..24956075 No primer for this exon
upstream ENSMUSE00000215247 Chr9:24937642..24937719 No primer for this exon

*** Putative Vector Insertion (Chr 9: 24935097 - 24937641) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000215245 Chr9:24934983..24935096 No primer for this exon
downstream ENSMUSE00000215250 Chr9:24929316..24929467 No primer for this exon
downstream ENSMUSE00000215248 Chr9:24918265..24918387 No primer for this exon
downstream ENSMUSE00000268605 Chr9:24914855..24915178 No primer for this exon
downstream ENSMUSE00000268585 Chr9:24913884..24913998 No primer for this exon
downstream ENSMUSE00000374724 Chr9:24912577..24913449 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTTAATCGCCTTGCAGCAC Chr9:24937573..24937593 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTGCTTCCTGACCATCTGC Chr9:24937663..24937683 60.42 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000008429