Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10213
Trapped Gene
Arf1 (ENSMUSG00000048076)
Vector Insertion
Chr 11: 59027026 - 59041674
Public Clones (sanger) (sanger) (sanger) (sanger) LST012 (baygenomics) P123F04 (ggtc)
(ggtc) P078E03 (ggtc) P099F10 (ggtc) (ggtc) P143D03 (ggtc) (ggtc)
P119A12 (ggtc) (ggtc) P011D05 (ggtc) P099F10 (ggtc) P123F04 (ggtc)
(ggtc) P119A12 (ggtc) (ggtc) P149A12 (ggtc) 5SP121D04 (ggtc)
Private Clones OST234793 (lexicon) OST223685 (lexicon) OST123194 (lexicon) OST119254 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000373310 (Chr11:59041675..59041718 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000373310 (Chr11:59041675..59041718 -)
Downstram Exon
ENSMUSE00000486396 (Chr11:59026842..59027025 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGAATCGATACTGGCCAAAG Chr11:59026982..59027001 59.53 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000373310 Chr11:59041675..59041718 No primer for this exon

*** Putative Vector Insertion (Chr 11: 59027026 - 59041674) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000486396 Chr11:59026842..59027025 GGAATCGATACTGGCCAAAG Chr11:59026982..59027001 59.53 50
downstream ENSMUSE00000480117 Chr11:59026645..59026755 CCACACGGTGAAGCTGATATT Chr11:59026684..59026704 60.01 47.62
downstream ENSMUSE00000579490 Chr11:59026323..59026447 TCGTTCACACGCTCTCTGTC Chr11:59026380..59026399 60.19 55
downstream ENSMUSE00000477891 Chr11:59024998..59026197 CAGCGAAACAGGTGATCTGA Chr11:59025507..59025526 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTTAATCGCCTTGCAGCAC Chr11:59038606..59038626 61.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTCGTGACTGGGAAAACC Chr11:59038607..59038627 63.24 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGTGAGTAATCGCCTTGCAG Chr11:59032654..59032674 60.8 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ATCTTGTGGGAGCGAAACCA Chr11:59041702..59041722 62.89 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048076