Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10227
Trapped Gene
Notch2 (ENSMUSG00000027878)
Vector Insertion
Chr 3: 97935358 - 97938481
Public Clones LST103 (baygenomics) PST065 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 57% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000491540 (Chr3:97935121..97935357 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACATCAACGAATGCCTGTC Chr3:97935255..97935274 59.09 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000491540 (Chr3:97935121..97935357 +)
Downstram Exon
ENSMUSE00000671895 (Chr3:97938482..97938499 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACATCAACGAATGCCTGTC Chr3:97935255..97935274 59.09 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000409345 Chr3:97851650..97851732 GTGTCGAGGTGGTCAAGAGC Chr3:97851658..97851677 60.87 60
upstream ENSMUSE00000404985 Chr3:97874783..97875042 AAAAACCGCTGTCAGAATGG Chr3:97874835..97874854 60.11 45
upstream ENSMUSE00000244757 Chr3:97876510..97876845 ATCTCATCCCTGCGAAAATG Chr3:97876541..97876560 60.04 45
upstream ENSMUSE00000173829 Chr3:97885840..97885962 CCTGTGAGCGGAATATCGAC Chr3:97885855..97885874 60.62 55
upstream ENSMUSE00000244740 Chr3:97902019..97902252 TCGATGACTGTGCCTATGCT Chr3:97902160..97902179 59.42 50
upstream ENSMUSE00000565998 Chr3:97903347..97903502 CCTGAACGGGCAGTACATTT Chr3:97903420..97903439 59.99 50
upstream ENSMUSE00000410900 Chr3:97904123..97904311 GAGTGTCTGAAGGGCTACGC Chr3:97904185..97904204 60.02 60
upstream ENSMUSE00000173851 Chr3:97905444..97905557 AAGTCAACCGCTTCCAGTGT Chr3:97905525..97905544 59.77 50
upstream ENSMUSE00000372606 Chr3:97906249..97906362 AGTGTGCCAGATCGACATTG Chr3:97906262..97906281 59.71 50
upstream ENSMUSE00000173865 Chr3:97908272..97908505 GGATGGGATCGACTCCTACA Chr3:97908345..97908364 59.89 55
upstream ENSMUSE00000173842 Chr3:97910970..97911080 ACCCTTGTATGCACGGAGTC Chr3:97911009..97911028 60 55
upstream ENSMUSE00000391377 Chr3:97915473..97915665 ATGTGAATGGTTTCCGGTGT Chr3:97915545..97915564 60.1 45
upstream ENSMUSE00000173837 Chr3:97916933..97917078 CCTGGTGAATGGCTACAGGT Chr3:97917035..97917054 59.99 55
upstream ENSMUSE00000357324 Chr3:97919155..97919268 AGATGAGTGTGCCTCCAACC Chr3:97919177..97919196 60.12 55
upstream ENSMUSE00000406771 Chr3:97920624..97920743 AGAGGCACCCAATTTTGAGA Chr3:97920691..97920710 59.67 45
upstream ENSMUSE00000392832 Chr3:97921116..97921268 TCCAAGCCGTGTATGAACAA Chr3:97921151..97921170 60.11 45
upstream ENSMUSE00000173846 Chr3:97924650..97924878 GAGCGAGCCCTGTAAGAATG Chr3:97924759..97924778 59.98 55
upstream ENSMUSE00000173840 Chr3:97925827..97926028 GCACGTGTGTTGATGGAATC Chr3:97925844..97925863 59.97 50
upstream ENSMUSE00000173839 Chr3:97927668..97927821 GTGATGTGCTCAACGTGTCC Chr3:97927777..97927796 60.17 55
upstream ENSMUSE00000357630 Chr3:97928072..97928256 GCAGCTTGATGAGTGTGCAT Chr3:97928178..97928197 60.02 50
upstream ENSMUSE00000173862 Chr3:97930035..97930167 GCATCGACCTTGTGAACCAT Chr3:97930117..97930136 60.94 50
upstream ENSMUSE00000491540 Chr3:97935121..97935357 GACATCAACGAATGCCTGTC Chr3:97935255..97935274 59.09 50

*** Putative Vector Insertion (Chr 3: 97935358 - 97938481) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000173859 Chr3:97938482..97938594 GGGACAACGACAGATGAAGC Chr3:97938594..97938613 60.67 55
downstream ENSMUSE00000671895 Chr3:97938482..97938499 No primer for this exon
downstream ENSMUSE00000173831 Chr3:97939249..97939754 TACTGGCACATCCTGACTCG Chr3:97939387..97939406 59.85 55
downstream ENSMUSE00000173834 Chr3:97941198..97941551 TTGTTTAATGCGCAAGTTGG Chr3:97941432..97941451 59.74 40
downstream ENSMUSE00000671894 Chr3:97941218..97941551 TTGTTTAATGCGCAAGTTGG Chr3:97941432..97941451 59.74 40
downstream ENSMUSE00000410647 Chr3:97942309..97942451 ACTGTCGGTTGTCGATCTCC Chr3:97942346..97942365 60.12 55
downstream ENSMUSE00000637280 Chr3:97942565..97942668 ACCGCGAGCAGATAGAGAAG Chr3:97942616..97942635 59.74 55
downstream ENSMUSE00000637278 Chr3:97942674..97942700 No primer for this exon
downstream ENSMUSE00000637277 Chr3:97942705..97942775 ATCCTGTCCCACAGGTTCAC Chr3:97942764..97942783 59.82 55
downstream ENSMUSE00000173843 Chr3:97943509..97943605 CTCTGACACTTGCACGGAGA Chr3:97943536..97943555 60.18 55
downstream ENSMUSE00000410856 Chr3:97945387..97945552 GTTCTGCCTGAGGAGGAGTG Chr3:97945516..97945535 59.99 60
downstream ENSMUSE00000173830 Chr3:97946816..97947117 GAAGCCAGCATCAGTGGAGT Chr3:97946846..97946865 60.42 55
downstream ENSMUSE00000173849 Chr3:97948285..97948432 GGGGGTAGTACCATCGTTCA Chr3:97948347..97948366 59.67 55
downstream ENSMUSE00000173847 Chr3:97949045..97949142 TATCTCTGTTGGCCCCATTC Chr3:97949131..97949150 59.89 50
downstream ENSMUSE00000507053 Chr3:97949976..97951367 TGAGAGCGCAGAAGTCAAGA Chr3:97950194..97950213 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGAGGTCCACAGAGTGTCCT Chr3:97938316..97938337 59.74 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATCCGTGACTGGGAAAACC Chr3:97938405..97938425 59.79 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027878