Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10240
Trapped Gene
Sema4b (ENSMUSG00000030539)
Vector Insertion
Chr 7: 87366719 - 87368819
Public Clones GST107 (baygenomics) G076B12 (ggtc) G074G07 (ggtc)
Private Clones OST441113 (lexicon) OST413413 (lexicon) OST359747 (lexicon)
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000672952 (Chr7:87365674..87366718 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACAAAAATGGATGGTGCTG Chr7:87366516..87366535 59.96 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000672952 (Chr7:87365674..87366718 +)
Downstram Exon
ENSMUSE00000317179 (Chr7:87368820..87368902 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACAAAAATGGATGGTGCTG Chr7:87366516..87366535 59.96 45 AAGAAACCGGGCCTTGTATG Chr7:87368898..87368917 61.22 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000507158 Chr7:87331727..87331877 TTCACGGGATACTCCAGGTC Chr7:87331757..87331776 59.93 55
upstream ENSMUSE00000475341 Chr7:87343405..87343656 TTCCACTTGAGCAACCTGAG Chr7:87343470..87343489 59.01 50
upstream ENSMUSE00000718257 Chr7:87343405..87343656 TTCCACTTGAGCAACCTGAG Chr7:87343470..87343489 59.01 50
upstream ENSMUSE00000200269 Chr7:87357682..87357845 ATGGCAAGACGCTGTATGTG Chr7:87357757..87357776 59.75 50
upstream ENSMUSE00000200268 Chr7:87358149..87358211 CAGATGCTGACAGGAAGCAG Chr7:87358162..87358181 59.73 55
upstream ENSMUSE00000200275 Chr7:87360510..87360608 ATCCTCCTGCCACTCAACAG Chr7:87360534..87360553 60.26 55
upstream ENSMUSE00000200283 Chr7:87361215..87361326 ACTTCAAGTCCACGGCTCTG Chr7:87361300..87361319 60.44 55
upstream ENSMUSE00000317215 Chr7:87361616..87361729 CTGAGAGCTCCCTCAACTGG Chr7:87361703..87361722 60.13 60
upstream ENSMUSE00000317206 Chr7:87361834..87361985 AGCCCCATAGGTGATGATGA Chr7:87361878..87361897 60.3 50
upstream ENSMUSE00000200282 Chr7:87363769..87363950 GCGCAAGACCCTTTTCTATG Chr7:87363912..87363931 59.85 50
upstream ENSMUSE00000200267 Chr7:87364072..87364222 TTGACGGCCTGTACAAGAAA Chr7:87364137..87364156 59.32 45
upstream ENSMUSE00000200266 Chr7:87365007..87365217 CCAGACCGAGTGCTGAACTT Chr7:87365058..87365077 60.44 55
upstream ENSMUSE00000200270 Chr7:87365328..87365443 TCCACATCATTGAGGAGCTG Chr7:87365370..87365389 59.79 50
upstream ENSMUSE00000200274 Chr7:87365674..87365840 CCTGTACCCAACCTGTGGAG Chr7:87365733..87365752 60.41 60
upstream ENSMUSE00000672952 Chr7:87365674..87366718 CACAAAAATGGATGGTGCTG Chr7:87366516..87366535 59.96 45

*** Putative Vector Insertion (Chr 7: 87366719 - 87368819) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000317179 Chr7:87368820..87368902 AAGAAACCGGGCCTTGTATG Chr7:87368898..87368917 61.22 50
downstream ENSMUSE00000406768 Chr7:87369482..87371410 GATTCTCAACTTCGGCTTGC Chr7:87370599..87370618 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGATGTTCTCCAAGTGAACG Chr7:87366752..87366772 58.13 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030539