Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1025
Trapped Gene
Fbxo31 (ENSMUSG00000031811)
Vector Insertion
Chr 8: 124082995 - 124083822
Public Clones AY0652 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000301728 (Chr8:124083823..124083990 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTACCTGCCACCTCATGACC Chr8:124083942..124083961 60.4 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000301728 (Chr8:124083823..124083990 -)
Downstram Exon
ENSMUSE00000213278 (Chr8:124082920..124082994 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTACCTGCCACCTCATGACC Chr8:124083942..124083961 60.4 60 TGGAGAACTCGTCCCTCTTC Chr8:124082948..124082967 59.38 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000337691 Chr8:124102358..124102691 GAATCTTGCACACGGACACC Chr8:124102383..124102402 61.54 55
upstream ENSMUSE00000301789 Chr8:124090175..124090246 ATGGCGTTTGTGAGAACCTG Chr8:124090224..124090243 61.1 50
upstream ENSMUSE00000301757 Chr8:124084286..124084362 GTACGGAGGATTGCTGAACG Chr8:124084291..124084310 60.66 55
upstream ENSMUSE00000301728 Chr8:124083823..124083990 GTACCTGCCACCTCATGACC Chr8:124083942..124083961 60.4 60

*** Putative Vector Insertion (Chr 8: 124082995 - 124083822) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000213278 Chr8:124082920..124082994 TGGAGAACTCGTCCCTCTTC Chr8:124082948..124082967 59.38 55
downstream ENSMUSE00000213273 Chr8:124080142..124080251 CATGTGCTCGTGGAAGATGT Chr8:124080164..124080183 59.71 50
downstream ENSMUSE00000213276 Chr8:124079106..124079259 GCTGAGCATCACAATCTCCA Chr8:124079120..124079139 59.95 50
downstream ENSMUSE00000213275 Chr8:124078005..124078351 AATCCTGGAGAGCTCGTTGA Chr8:124078219..124078238 59.95 50
downstream ENSMUSE00000301612 Chr8:124075918..124076345 GAGGAGGTGTGCGTTCATTT Chr8:124076020..124076039 60.12 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCACATCCAGGTAGAGGAG Chr8:124083812..124083832 59.68 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCACATCCAGGTAGAGGAG Chr8:124083812..124083832 59.68 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031811