Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10254
Trapped Gene
Fat1 (ENSMUSG00000070047)
Vector Insertion
Chr 8: 46095966 - 46098317
Public Clones RST011 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000637101 (Chr8:46095755..46095965 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTTTGAGGAATCGGTTTTC Chr8:46095852..46095871 59.55 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000637101 (Chr8:46095755..46095965 +)
Downstram Exon
ENSMUSE00000637100 (Chr8:46098318..46098457 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTTTGAGGAATCGGTTTTC Chr8:46095852..46095871 59.55 45 GTTCTGCATCAAGGGGCTTA Chr8:46098398..46098417 60.21 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683877 Chr8:46035568..46038835 GGAGCAGATAACCACCGTGT Chr8:46037325..46037344 60 55
upstream ENSMUSE00000683900 Chr8:46035568..46038835 GGAGCAGATAACCACCGTGT Chr8:46037325..46037344 60 55
upstream ENSMUSE00000637106 Chr8:46074285..46074599 CCACTACTGGCTCACGGTCT Chr8:46074328..46074347 60.32 60
upstream ENSMUSE00000608098 Chr8:46092596..46092657 CTCATCACAACCACGTCGAG Chr8:46092598..46092617 60.31 55
upstream ENSMUSE00000608097 Chr8:46095147..46095479 TTCTCCATCGAACCCAAAAC Chr8:46095405..46095424 59.91 45
upstream ENSMUSE00000637101 Chr8:46095755..46095965 CGTTTGAGGAATCGGTTTTC Chr8:46095852..46095871 59.55 45

*** Putative Vector Insertion (Chr 8: 46095966 - 46098317) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000637100 Chr8:46098318..46098457 GTTCTGCATCAAGGGGCTTA Chr8:46098398..46098417 60.21 50
downstream ENSMUSE00000608094 Chr8:46102719..46102994 CATGGTCAAGCTTTTCAGCA Chr8:46102965..46102984 59.99 45
downstream ENSMUSE00000608093 Chr8:46103189..46103399 TTGACAACAATCCTGGCAAA Chr8:46103244..46103263 60.09 40
downstream ENSMUSE00000637097 Chr8:46108158..46112225 CCCGATGTTCACCTCGTACT Chr8:46111168..46111187 59.99 55
downstream ENSMUSE00000637096 Chr8:46112838..46113034 GTCGTTGGCATCGAGAACTT Chr8:46113016..46113035 60.26 50
downstream ENSMUSE00000683894 Chr8:46114810..46114963 AGACCTGCATGACCAGCTTC Chr8:46114873..46114892 60.42 55
downstream ENSMUSE00000637126 Chr8:46115466..46115699 GTCCGTGGCCTTGACTAGAA Chr8:46115542..46115561 60.26 55
downstream ENSMUSE00000637125 Chr8:46116619..46117008 ATTCGACCAGCGAGTAGGAA Chr8:46116657..46116676 59.84 50
downstream ENSMUSE00000637124 Chr8:46118693..46118907 GGGGCTGTTATCGTTGATGT Chr8:46118841..46118860 59.82 50
downstream ENSMUSE00000608088 Chr8:46118709..46118907 GGGGCTGTTATCGTTGATGT Chr8:46118841..46118860 59.82 50
downstream ENSMUSE00000608087 Chr8:46119186..46119323 GGGTCAATTGTGAACGGACT Chr8:46119280..46119299 59.83 50
downstream ENSMUSE00000637123 Chr8:46119186..46119323 GGGTCAATTGTGAACGGACT Chr8:46119280..46119299 59.83 50
downstream ENSMUSE00000608086 Chr8:46120819..46120962 CACCGTGGTTGTGTTGACTC Chr8:46120893..46120912 60.05 55
downstream ENSMUSE00000608085 Chr8:46121473..46121670 CACCTCAAAGGCGTTTTCAT Chr8:46121598..46121617 60.11 45
downstream ENSMUSE00000608084 Chr8:46122030..46122831 ATTTCCTCAACGTCCGTCAC Chr8:46122658..46122677 59.97 50
downstream ENSMUSE00000608083 Chr8:46123614..46123745 GGGCACACGCAGCTATACTT Chr8:46123722..46123741 60.3 55
downstream ENSMUSE00000608082 Chr8:46125154..46125311 GCGGTACTTCACGAAGCTGT Chr8:46125203..46125222 60.46 55
downstream ENSMUSE00000683886 Chr8:46125154..46125305 GCGGTACTTCACGAAGCTGT Chr8:46125203..46125222 60.46 55
downstream ENSMUSE00000608081 Chr8:46125888..46126350 TCGTTGACCTGAATGCTCTG Chr8:46125973..46125992 59.98 50
downstream ENSMUSE00000683884 Chr8:46125933..46126350 TCGTTGACCTGAATGCTCTG Chr8:46125973..46125992 59.98 50
downstream ENSMUSE00000608080 Chr8:46127234..46127387 GCGCTGCACTTGCAGTAATA Chr8:46127258..46127277 60.19 50
downstream ENSMUSE00000683876 Chr8:46127234..46127365 GCGCTGCACTTGCAGTAATA Chr8:46127258..46127277 60.19 50
downstream ENSMUSE00000683882 Chr8:46127234..46127380 GCGCTGCACTTGCAGTAATA Chr8:46127258..46127277 60.19 50
downstream ENSMUSE00000683875 Chr8:46127386..46127416 No primer for this exon
downstream ENSMUSE00000683880 Chr8:46127517..46127673 GCACCATCCAAACTGTCAAA Chr8:46127640..46127659 59.55 45
downstream ENSMUSE00000608079 Chr8:46127563..46127673 TCCCCTAAAGCCTGAGTCAC Chr8:46127671..46127690 59.28 55
downstream ENSMUSE00000608078 Chr8:46129277..46129908 GAATTGCGGTCAAGGTTGTT Chr8:46129726..46129745 59.98 45
downstream ENSMUSE00000608077 Chr8:46130385..46130522 AAGGAGCTAAGCGACTGCAC Chr8:46130499..46130518 59.79 55
downstream ENSMUSE00000637111 Chr8:46135196..46135231 GTCAGGAGCAGCCAAAGATT Chr8:46135218..46135237 59.43 50
downstream ENSMUSE00000683873 Chr8:46136135..46137590 ACCCGGTCGATTACAGTCAG Chr8:46136963..46136982 59.99 55
downstream ENSMUSE00000683879 Chr8:46136135..46137611 ACCCGGTCGATTACAGTCAG Chr8:46136963..46136982 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCCTCTGTGGTTTGACATC Chr8:46095943..46095963 59.68 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCCTCTGTGGTTTGACATC Chr8:46095943..46095963 59.68 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000070047