Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10259
Trapped Gene
AI480653 (ENSMUSG00000047434)
Vector Insertion
Chr 16: 31007933 - 31050717
Public Clones (sanger) KST219 (baygenomics) P070E02 (ggtc) G044E04 (ggtc) G077F12 (ggtc)
IST11921F1 (tigm)
Private Clones OST431155 (lexicon) OST360148 (lexicon) OST43570 (lexicon)
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000373867 (Chr16:31050718..31050865 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCCATGATGTTGCTGTGC Chr16:31050841..31050860 60.27 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000373867 (Chr16:31050718..31050865 -)
Downstram Exon
ENSMUSE00000335839 (Chr16:31007800..31007932 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCCATGATGTTGCTGTGC Chr16:31050841..31050860 60.27 50 AAACAGCTCTCGGATGTTGG Chr16:31007846..31007865 60.26 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000336588 Chr16:31080921..31081466 GGTGTGCGCCTTCTACTACC Chr16:31081301..31081320 59.76 60
upstream ENSMUSE00000373867 Chr16:31050718..31050865 CTTCCATGATGTTGCTGTGC Chr16:31050841..31050860 60.27 50

*** Putative Vector Insertion (Chr 16: 31007933 - 31050717) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000335839 Chr16:31007800..31007932 AAACAGCTCTCGGATGTTGG Chr16:31007846..31007865 60.26 50
downstream ENSMUSE00000413174 Chr16:30955722..30957820 GATGGCTGTAGAGCGGAGAC Chr16:30957659..30957678 59.98 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr16:31017647..31017667 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACGTGTCCCTATGGGTTGAA Chr16:31017713..31017733 60.23 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT Chr16:31017796..31017816 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCAGACACTTTCCCTCTGCT Chr16:31038880..31038900 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047434