Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10268
Trapped Gene
Ctsc (ENSMUSG00000030560)
Vector Insertion
Chr 7: 95456655 - 95457909
Public Clones KST258 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000200406 (Chr7:95456523..95456654 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTATCTTGCAGCCCCTATGC Chr7:95456630..95456649 59.7 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000200406 (Chr7:95456523..95456654 +)
Downstram Exon
ENSMUSE00000368279 (Chr7:95457910..95458821 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTATCTTGCAGCCCCTATGC Chr7:95456630..95456649 59.7 55 GCATGATTTGTCAGCTCGAA Chr7:95458240..95458259 59.96 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000335816 Chr7:95426647..95426884 CCAACTGCACCTACCCTGAT Chr7:95426795..95426814 59.99 55
upstream ENSMUSE00000200403 Chr7:95429897..95430042 CCAAGGCTTCGAGATTGTGT Chr7:95429991..95430010 60.26 50
upstream ENSMUSE00000633701 Chr7:95435404..95435488 TGCCACATCTGAGGAACAAA Chr7:95435465..95435484 60.24 45
upstream ENSMUSE00000633700 Chr7:95435793..95435800 No primer for this exon
upstream ENSMUSE00000200405 Chr7:95445593..95445759 TTGGCAAGAAGGTGGAAAGT Chr7:95445687..95445706 59.71 45
upstream ENSMUSE00000200402 Chr7:95447955..95448107 AGGCCATCAATACCGTTCAG Chr7:95447996..95448015 59.96 50
upstream ENSMUSE00000325162 Chr7:95450695..95450810 GTTAGCCCTGTTCGAAACCA Chr7:95450789..95450808 60.11 50
upstream ENSMUSE00000200406 Chr7:95456523..95456654 GTATCTTGCAGCCCCTATGC Chr7:95456630..95456649 59.7 55

*** Putative Vector Insertion (Chr 7: 95456655 - 95457909) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000368279 Chr7:95457910..95458821 GCATGATTTGTCAGCTCGAA Chr7:95458240..95458259 59.96 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTATCTTGCAGCCCCTATGC Chr7:95456631..95456651 59.7 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTATCTTGCAGCCCCTATGC Chr7:95456631..95456651 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030560