Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10281
Trapped Gene
B3gnt2 (ENSMUSG00000051650)
Vector Insertion
Chr 11: 22734864 - 22737196
Public Clones KST308 (baygenomics) CMHD-GT_474B1-3 (cmhd)
Private Clones OST319699 (lexicon) OST181220 (lexicon) OST176635 (lexicon) OST131449 (lexicon)
OST131117 (lexicon) OST53965 (lexicon) OST45110 (lexicon) OST42188 (lexicon)
OST39999 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000357467 (Chr11:22734865..22737195 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATACGGGAATGTGCCTTCAG Chr11:22736164..22736183 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000357467 (Chr11:22734865..22737195 -)
Downstram Exon
ENSMUSE00000493466 (Chr11:22734857..22737195 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATACGGGAATGTGCCTTCAG Chr11:22736164..22736183 59.96 50 GCCCAGCAACTTGACTCTTC Chr11:22737129..22737148 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000331247 Chr11:22760218..22760336 AACCTGAAGGTCCGAAGAGG Chr11:22760292..22760311 60.62 55
upstream ENSMUSE00000370857 Chr11:22759494..22759703 GAGCTGGAGGTGTCCCTAGA Chr11:22759498..22759517 59.4 60
upstream ENSMUSE00000357467 Chr11:22734865..22737195 ATACGGGAATGTGCCTTCAG Chr11:22736164..22736183 59.96 50

*** Putative Vector Insertion (Chr 11: 22734864 - 22737196) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000493466 Chr11:22734857..22737195 GCCCAGCAACTTGACTCTTC Chr11:22737129..22737148 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGCATCAGAGTCACAGTT Chr11:22737223..22737243 59.26 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGCATCAGAGTCACAGTT Chr11:22737223..22737243 59.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051650