Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1030
Trapped Gene
Rpl13a (ENSMUSG00000003426)
Vector Insertion
Chr 7: 52382939 - 52384069
Public Clones AY0548 (sanger) AM1205 (sanger) CC0058 (sanger) XT0073 (sanger)
XS0436 (sanger) E048C01 (ggtc) E048A01 (ggtc) 3SE289D11 (ggtc) E048C01 (ggtc)
D129C02 (ggtc) P109D05 (ggtc) PST2572-NR (escells) PST19870-NL (escells)
IST13759F4 (tigm)
Private Clones OST440952 (lexicon) OST429576 (lexicon) OST407539 (lexicon) OST361109 (lexicon)
OST355671 (lexicon) OST236607 (lexicon) OST176738 (lexicon) OST115800 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662249 (Chr7:52384070..52384107 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662249 (Chr7:52384070..52384107 -)
Downstram Exon
ENSMUSE00000662248 (Chr7:52382866..52382938 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662249 Chr7:52384070..52384107 No primer for this exon

*** Putative Vector Insertion (Chr 7: 52382939 - 52384069) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000662248 Chr7:52382866..52382938 No primer for this exon
downstream ENSMUSE00000203254 Chr7:52382579..52382644 No primer for this exon
downstream ENSMUSE00000203242 Chr7:52382361..52382462 No primer for this exon
downstream ENSMUSE00000203251 Chr7:52382079..52382164 No primer for this exon
downstream ENSMUSE00000499860 Chr7:52381848..52381907 No primer for this exon
downstream ENSMUSE00000203246 Chr7:52381485..52381607 No primer for this exon
downstream ENSMUSE00000662247 Chr7:52381293..52381402 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACATC Chr7:52383998..52384019 63.08 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGAAACCCTGCGACAAGAC Chr7:52384111..52384131 59.33 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 3 CTCTCGTGACTGGGAAAACC Chr7:52384041..52384061 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003426