Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10300
Trapped Gene
Ergic1 (ENSMUSG00000001576)
Vector Insertion
Chr 17: 26761630 - 26766499
Public Clones KST018 (baygenomics) KST011 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000139382 (Chr17:26761535..26761629 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000139382 (Chr17:26761535..26761629 +)
Downstram Exon
ENSMUSE00000139380 (Chr17:26766500..26766624 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000387417 Chr17:26698471..26698577 No primer for this exon
upstream ENSMUSE00000251217 Chr17:26745538..26745599 No primer for this exon
upstream ENSMUSE00000139384 Chr17:26751301..26751373 No primer for this exon
upstream ENSMUSE00000139382 Chr17:26761535..26761629 No primer for this exon

*** Putative Vector Insertion (Chr 17: 26761630 - 26766499) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000139380 Chr17:26766500..26766624 No primer for this exon
downstream ENSMUSE00000139370 Chr17:26771362..26771466 No primer for this exon
downstream ENSMUSE00000139378 Chr17:26772931..26772991 No primer for this exon
downstream ENSMUSE00000139372 Chr17:26775688..26775788 No primer for this exon
downstream ENSMUSE00000139368 Chr17:26778527..26778649 No primer for this exon
downstream ENSMUSE00000373302 Chr17:26792012..26792295 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCTGTGGGTGATCTAATCG Chr17:26764667..26764687 60.48 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGATCCGTGACTGGGAAAA Chr17:26764675..26764695 60.9 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001576