Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10306
Trapped Gene
Man2a1 (ENSMUSG00000024085)
Vector Insertion
Chr 17: 65084408 - 65090019
Public Clones KST059 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 86% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000138275 (Chr17:65084274..65084407 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGGCGTCCATGACAATAA Chr17:65084333..65084352 59.54 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000138275 (Chr17:65084274..65084407 +)
Downstram Exon
ENSMUSE00000138280 (Chr17:65090020..65090223 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGGCGTCCATGACAATAA Chr17:65084333..65084352 59.54 45 TTGTATTGTCCGCAGGTTGA Chr17:65090220..65090239 60.11 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000483264 Chr17:64950989..64951210 GCGATCTTCTGCGTCGTAAT Chr17:64951112..64951131 60.38 50
upstream ENSMUSE00000306920 Chr17:64973868..64974119 CGCTGAGAACAACGAGATCA Chr17:64973918..64973937 60.14 50
upstream ENSMUSE00000306900 Chr17:64974647..64974791 ATCCAGATGGTGGAGTTTGG Chr17:64974681..64974700 59.78 50
upstream ENSMUSE00000495787 Chr17:64985824..64985995 CCTTGCAAAATGGTGGGATA Chr17:64985942..64985961 60.69 45
upstream ENSMUSE00000493264 Chr17:65000536..65000663 GCTGGGTTATGCCTGATGAA Chr17:65000574..65000593 61 50
upstream ENSMUSE00000494670 Chr17:65008241..65008414 AAAGCGTGCTGGATTTTCAC Chr17:65008308..65008327 60.26 45
upstream ENSMUSE00000491621 Chr17:65016077..65016263 CAGCTACGACATCCCTCACA Chr17:65016123..65016142 59.85 55
upstream ENSMUSE00000138260 Chr17:65018752..65018929 GGAGACGACTTTCGGTTCAG Chr17:65018825..65018844 59.84 55
upstream ENSMUSE00000138268 Chr17:65021188..65021390 GGCTACTTCACGTCCAGACC Chr17:65021329..65021348 59.73 60
upstream ENSMUSE00000138276 Chr17:65024405..65024587 GTTGGCCTTGAAACAAGCTC Chr17:65024426..65024445 59.86 50
upstream ENSMUSE00000657073 Chr17:65029092..65029206 CAGATCCTTCCAAAGCCTTCT Chr17:65029178..65029198 59.83 47.62
upstream ENSMUSE00000657072 Chr17:65030895..65030965 CAAGATTCTCTGCCCCAAAA Chr17:65030913..65030932 60.18 45
upstream ENSMUSE00000540937 Chr17:65060044..65060209 TTGGAACGACATGAGGACAA Chr17:65060170..65060189 60.09 45
upstream ENSMUSE00000138264 Chr17:65061592..65061813 CGATTTGGTTTGACCGATCT Chr17:65061782..65061801 59.93 45
upstream ENSMUSE00000332597 Chr17:65062902..65063024 CAGCATGAACTGAAGGTCCA Chr17:65062929..65062948 59.83 50
upstream ENSMUSE00000450810 Chr17:65063938..65064052 CTAAGACCGCCCTTTGTCAG Chr17:65063950..65063969 59.87 55
upstream ENSMUSE00000306603 Chr17:65080544..65080677 GGAATGTGCATAACCGTGAG Chr17:65080589..65080608 59 50
upstream ENSMUSE00000138278 Chr17:65083064..65083205 ATGGCGTATATCCAGGATGC Chr17:65083127..65083146 59.77 50
upstream ENSMUSE00000138275 Chr17:65084274..65084407 CAAGGCGTCCATGACAATAA Chr17:65084333..65084352 59.54 45

*** Putative Vector Insertion (Chr 17: 65084408 - 65090019) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000138280 Chr17:65090020..65090223 TTGTATTGTCCGCAGGTTGA Chr17:65090220..65090239 60.11 45
downstream ENSMUSE00000414888 Chr17:65100124..65100234 CTCATCCGAATAGCCTTTGC Chr17:65100150..65100169 59.81 50
downstream ENSMUSE00000540934 Chr17:65101754..65104450 TTGAGGGATTGCACTTTTCC Chr17:65102424..65102443 60.05 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCAAGCTGTACAAGGAAGG Chr17:65087398..65087418 59.88 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCAAGCTGTACAAGGAAGG Chr17:65087398..65087418 59.88 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024085