Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10326
Trapped Gene
Lrig2 (ENSMUSG00000032913)
Vector Insertion
Chr 3: 104301478 - 104315378
Public Clones LST050 (baygenomics) G065H12 (ggtc) IST14803H5 (tigm) IST12242D2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000360131 (Chr3:104315379..104315779 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTCTCCTCAGCCGACTCTC Chr3:104315657..104315676 59.82 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000360131 (Chr3:104315379..104315779 -)
Downstram Exon
ENSMUSE00000587984 (Chr3:104301412..104301477 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTCTCCTCAGCCGACTCTC Chr3:104315657..104315676 59.82 60 TTCCAAGGTGTTGTTCCAGTT Chr3:104301410..104301430 59.48 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000360131 Chr3:104315379..104315779 TCTCTCCTCAGCCGACTCTC Chr3:104315657..104315676 59.82 60

*** Putative Vector Insertion (Chr 3: 104301478 - 104315378) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000587984 Chr3:104301412..104301477 TTCCAAGGTGTTGTTCCAGTT Chr3:104301410..104301430 59.48 42.86
downstream ENSMUSE00000587983 Chr3:104298554..104298628 No primer for this exon
downstream ENSMUSE00000587982 Chr3:104297981..104298115 GCTCGAATGCTTCTGCATTTA Chr3:104298050..104298070 60.49 42.86
downstream ENSMUSE00000587981 Chr3:104295612..104295755 GAAGACCTTGGGTGGAATCA Chr3:104295613..104295632 59.9 50
downstream ENSMUSE00000587980 Chr3:104295334..104295477 TAATTCCATTCCGCTGCATT Chr3:104295361..104295380 60.42 40
downstream ENSMUSE00000587979 Chr3:104294791..104294934 TTGCTGTAACATTCGCAAGC Chr3:104294843..104294862 60.02 45
downstream ENSMUSE00000587978 Chr3:104294453..104294596 CGGGTCAGCTGGTTATAGGA Chr3:104294548..104294567 60.09 55
downstream ENSMUSE00000587977 Chr3:104285778..104285858 GAAAAGGCTTCGCTAGCATC Chr3:104285780..104285799 59.21 50
downstream ENSMUSE00000587976 Chr3:104284032..104284103 CTCAAGGCCAATGAATGCTT Chr3:104284024..104284043 60.21 45
downstream ENSMUSE00000587975 Chr3:104283705..104283773 No primer for this exon
downstream ENSMUSE00000315278 Chr3:104272408..104272571 TCAAATGACAATCGCAGAGC Chr3:104272509..104272528 59.96 45
downstream ENSMUSE00000315272 Chr3:104270966..104271286 TGAAGAGGCGCAAGACACTA Chr3:104271037..104271056 59.74 50
downstream ENSMUSE00000315265 Chr3:104269410..104269691 ATGACATGCATGCGTCTTTC Chr3:104269507..104269526 59.69 45
downstream ENSMUSE00000565673 Chr3:104267782..104268231 GATGACAATGCCAACTGTGG Chr3:104267860..104267879 59.97 50
downstream ENSMUSE00000488391 Chr3:104266582..104266731 TCTGTGTGTGTACCCGTTGG Chr3:104266570..104266589 60.48 55
downstream ENSMUSE00000565672 Chr3:104265324..104265611 TCATCCTCTCATGGTTGGTG Chr3:104265335..104265354 59.47 50
downstream ENSMUSE00000513067 Chr3:104257907..104261887 GAGCTACGCTGATGTGGTCA Chr3:104261539..104261558 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGCAGAAACTCTCATTTTGACTT Chr3:104303388..104303412 59.47 33.33 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCTCGTGACTGGGAAAAC Chr3:104303312..104303332 59.85 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTTAATCGCCTTGCAGCACA Chr3:104303711..104303731 62.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGCTTGCTAGAGATGGGATGA Chr3:104303750..104303771 60.89 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032913