Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10335
Trapped Gene
Ccdc58 (ENSMUSG00000075229)
Vector Insertion
Chr 16: 36085250 - 36089986
Public Clones XA052 (baygenomics) D097F09 (ggtc) D097F09 (ggtc) FHCRC-GT-S21-2E1 (fhcrc)
IST11589E4 (tigm)
Private Clones OST470229 (lexicon) OST467997 (lexicon) OST442393 (lexicon) OST427668 (lexicon)
OST427664 (lexicon) OST375677 (lexicon) OST341705 (lexicon) OST340149 (lexicon)
OST336681 (lexicon) OST319396 (lexicon) OST318355 (lexicon) OST250849 (lexicon)
OST215230 (lexicon) OST140885 (lexicon) OST109274 (lexicon) OST106055 (lexicon)
OST89694 (lexicon) OST68990 (lexicon) OST67306 (lexicon)
Severity of mutation (?) Insertion after 75% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000644038 (Chr16:36085103..36085249 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGATGGCAGCTCATGTCAGT Chr16:36085104..36085123 60.44 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000644038 (Chr16:36085103..36085249 +)
Downstram Exon
ENSMUSE00000644037 (Chr16:36089987..36090046 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGATGGCAGCTCATGTCAGT Chr16:36085104..36085123 60.44 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000644041 Chr16:36072173..36072223 CTGTGAAGAGTTCGCCGAGT Chr16:36072199..36072218 60.59 55
upstream ENSMUSE00000644039 Chr16:36082777..36082902 TACGGTTCCAACAGCTTCCT Chr16:36082833..36082852 59.73 50
upstream ENSMUSE00000644038 Chr16:36085103..36085249 TGATGGCAGCTCATGTCAGT Chr16:36085104..36085123 60.44 50

*** Putative Vector Insertion (Chr 16: 36085250 - 36089986) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000644037 Chr16:36089987..36090046 No primer for this exon
downstream ENSMUSE00000644036 Chr16:36091920..36092204 GCGATGAGATGACCGAGTCT Chr16:36092009..36092028 60.38 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGCCCCAGATACAACCTT Chr16:36088282..36088302 59.83 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGCCCCAGATACAACCTC Chr16:36088282..36088302 60.33 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075229