Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10358
Trapped Gene
Polr2l (ENSMUSG00000038489)
Vector Insertion
Chr 7: 148659304 - 148660926
Public Clones (sanger) XB037 (baygenomics) D137H03 (ggtc) D137H03 (ggtc) CMHD-GT_109C9-3 (cmhd)
CMHD-GT_249B2-3 (cmhd) CMHD-GT_223H2-3 (cmhd) PST20106-NR (escells) E12 (vanderbilt)
IST15072D11 (tigm)
Private Clones OST430578 (lexicon) OST344810 (lexicon) OST284486 (lexicon) OST213958 (lexicon)
OST211869 (lexicon) OST210884 (lexicon) OST210390 (lexicon) OST29346 (lexicon)
OST27764 (lexicon) OST20473 (lexicon) OST18497 (lexicon)
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000230432 (Chr7:148660927..148661031 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGATCGTCGGCAACAAAT Chr7:148660970..148660989 60.08 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000230432 (Chr7:148660927..148661031 -)
Downstram Exon
ENSMUSE00000668186 (Chr7:148659029..148659303 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGATCGTCGGCAACAAAT Chr7:148660970..148660989 60.08 45 CCAGCGGTCACTTCTCTAGG Chr7:148659166..148659185 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000230432 Chr7:148660927..148661031 GAAGATCGTCGGCAACAAAT Chr7:148660970..148660989 60.08 45

*** Putative Vector Insertion (Chr 7: 148659304 - 148660926) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000668186 Chr7:148659029..148659303 CCAGCGGTCACTTCTCTAGG Chr7:148659166..148659185 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGACTGGTAATCGCCTTG Chr7:148660864..148660884 60.65 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACAAATGGGAAGCCTACCTG Chr7:148660954..148660975 60.36 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGGCCTTGAAAAGCTACTGC Chr7:148661046..148661066 61.25 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGGCCTTGAAAAGCTACTGC Chr7:148661046..148661066 61.25 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038489