Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10362
Trapped Gene
Setd6 (ENSMUSG00000031671)
Vector Insertion
Chr 8: 98240702 - 98240820
Public Clones XB067A (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000241403 (Chr8:98240507..98240701 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCCTCGTGATGGCTTATAG Chr8:98240682..98240701 59.69 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000241403 (Chr8:98240507..98240701 +)
Downstram Exon
ENSMUSE00000241394 (Chr8:98240821..98240941 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCCTCGTGATGGCTTATAG Chr8:98240682..98240701 59.69 55 TGAGTTGGGCTCCTTTTCAT Chr8:98240872..98240891 59.67 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000241414 Chr8:98239813..98240170 GTCCTAAGGTGACGGTGAGC Chr8:98240018..98240037 59.73 60
upstream ENSMUSE00000211645 Chr8:98240253..98240394 ATCACCCTGGAGCCCTTACT Chr8:98240329..98240348 59.96 55
upstream ENSMUSE00000241403 Chr8:98240507..98240701 GCCCTCGTGATGGCTTATAG Chr8:98240682..98240701 59.69 55

*** Putative Vector Insertion (Chr 8: 98240702 - 98240820) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000241394 Chr8:98240821..98240941 TGAGTTGGGCTCCTTTTCAT Chr8:98240872..98240891 59.67 45
downstream ENSMUSE00000211648 Chr8:98241821..98242001 GTAGCCACCATCCGGAGATA Chr8:98241846..98241865 59.92 55
downstream ENSMUSE00000211649 Chr8:98242093..98242235 TGTGGTGGCTAGCTCCTCTT Chr8:98242232..98242251 60.01 55
downstream ENSMUSE00000211647 Chr8:98242376..98242904 TGCCAAACTGTCGTCTTCTG Chr8:98242465..98242484 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCCTCGTGATGGCTTATAG Chr8:98240683..98240703 59.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCCTCGTGATGGCTTATAG Chr8:98240683..98240703 59.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031671