Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10382
Trapped Gene
Phf3 (ENSMUSG00000048874)
Vector Insertion
Chr 1: 30886687 - 30887317
Public Clones CT070 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000315372 (Chr1:30886705..30887316 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCCGAAGTTTTTCTCTGG Chr1:30886827..30886846 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000315372 (Chr1:30886705..30887316 -)
Downstram Exon
ENSMUSE00000630483 (Chr1:30886688..30888404 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCCGAAGTTTTTCTCTGG Chr1:30886827..30886846 59.99 50 CCTCACCATAGCCCAGTGTT Chr1:30887618..30887637 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000630485 Chr1:30919832..30920101 GCAATGATCCCAATTTCCAG Chr1:30919848..30919867 60.27 45
upstream ENSMUSE00000630484 Chr1:30893950..30894111 TCACCTCGTTTAATGGCACA Chr1:30893952..30893971 60.11 45
upstream ENSMUSE00000315372 Chr1:30886705..30887316 CAGCCGAAGTTTTTCTCTGG Chr1:30886827..30886846 59.99 50
upstream ENSMUSE00000630482 Chr1:30886688..30886702 No primer for this exon
upstream ENSMUSE00000630483 Chr1:30886688..30888404 AACACTGGGCTATGGTGAGG Chr1:30887640..30887659 59.99 55

*** Putative Vector Insertion (Chr 1: 30886687 - 30887317) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000604101 Chr1:30881055..30881364 CCATTTGCTGTGCTTGAGAA Chr1:30881260..30881279 59.99 45
downstream ENSMUSE00000630481 Chr1:30881055..30881364 CCATTTGCTGTGCTTGAGAA Chr1:30881260..30881279 59.99 45
downstream ENSMUSE00000468070 Chr1:30877976..30878159 TCCGAGGTAAATGTGGTTGG Chr1:30878035..30878054 60.74 50
downstream ENSMUSE00000630480 Chr1:30877976..30878159 TCCGAGGTAAATGTGGTTGG Chr1:30878035..30878054 60.74 50
downstream ENSMUSE00000315471 Chr1:30877528..30877672 AGGCTTGGAAGTAGCAGCAG Chr1:30877565..30877584 59.78 55
downstream ENSMUSE00000702069 Chr1:30877528..30877672 AGGCTTGGAAGTAGCAGCAG Chr1:30877565..30877584 59.78 55
downstream ENSMUSE00000315459 Chr1:30876926..30877082 TTTTTGTGGCAACCTTTGCT Chr1:30877002..30877021 60.65 40
downstream ENSMUSE00000702068 Chr1:30876926..30877082 TTTTTGTGGCAACCTTTGCT Chr1:30877002..30877021 60.65 40
downstream ENSMUSE00000315449 Chr1:30873313..30873429 CTGTTCTCCCTTCGTCTCCA Chr1:30873295..30873314 60.38 55
downstream ENSMUSE00000702067 Chr1:30873313..30873429 CTGTTCTCCCTTCGTCTCCA Chr1:30873295..30873314 60.38 55
downstream ENSMUSE00000476485 Chr1:30870805..30870936 TCGTGATTGGTCGTCTTTCC Chr1:30870860..30870879 61.05 50
downstream ENSMUSE00000551418 Chr1:30870416..30870936 TCCTACCTGGATCTCGATGG Chr1:30870777..30870796 60.03 55
downstream ENSMUSE00000315429 Chr1:30869862..30869997 No primer for this exon
downstream ENSMUSE00000349139 Chr1:30868617..30868812 TTGAAGACAACGCATCTGCT Chr1:30868674..30868693 59.6 45
downstream ENSMUSE00000398107 Chr1:30867528..30867675 GTTCAATCGAGCCAGAAAGG Chr1:30867599..30867618 59.81 50
downstream ENSMUSE00000315573 Chr1:30865568..30865657 TGCCACCTACTTGAATGCTG Chr1:30865605..30865624 59.86 50
downstream ENSMUSE00000315566 Chr1:30863014..30863209 ACACCATAGCGCTTTCTGCT Chr1:30863090..30863109 60.04 50
downstream ENSMUSE00000410830 Chr1:30859187..30862787 CCTCTCTTAGGCCGTGTCTG Chr1:30859804..30859823 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTGGTGAGCCGGAACTAAT Chr1:30887262..30887282 59.69 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGCGAAATTCTGGTGAGC Chr1:30887272..30887292 59.96 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048874