Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10384
Trapped Gene
Ptov1 (ENSMUSG00000038502)
Vector Insertion
Chr 7: 52120206 - 52120282
Public Clones PT065 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000510014 (Chr7:52120283..52120372 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAATTCTTGGCATGGAGTGG Chr7:52120302..52120321 59.93 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000510014 (Chr7:52120283..52120372 -)
Downstram Exon
ENSMUSE00000507974 (Chr7:52120132..52120205 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAATTCTTGGCATGGAGTGG Chr7:52120302..52120321 59.93 45 GATCTCCCCTTGGTTCACAT Chr7:52120112..52120131 58.79 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000485785 Chr7:52124721..52125034 No primer for this exon
upstream ENSMUSE00000483862 Chr7:52122745..52122882 TCTTCACCTGGGCTGACTCT Chr7:52122821..52122840 59.99 55
upstream ENSMUSE00000493133 Chr7:52122563..52122645 TAGACCCTTCTCGGACTCCA Chr7:52122621..52122640 59.8 55
upstream ENSMUSE00000510384 Chr7:52122430..52122487 CAGTGGCCCCAGAAGTTGAT Chr7:52122458..52122477 62.4 55
upstream ENSMUSE00000520620 Chr7:52122180..52122287 CCTGTTCCGAAACTCTCAGC Chr7:52122254..52122273 59.99 55
upstream ENSMUSE00000520486 Chr7:52120842..52120997 CTCATCCCCTACGACCAGAG Chr7:52120888..52120907 59.67 60
upstream ENSMUSE00000510014 Chr7:52120283..52120372 AAATTCTTGGCATGGAGTGG Chr7:52120302..52120321 59.93 45

*** Putative Vector Insertion (Chr 7: 52120206 - 52120282) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000507974 Chr7:52120132..52120205 GATCTCCCCTTGGTTCACAT Chr7:52120112..52120131 58.79 50
downstream ENSMUSE00000464754 Chr7:52119982..52120039 GAGGCCACTGGTCTGTTCTC Chr7:52119998..52120017 59.84 60
downstream ENSMUSE00000475079 Chr7:52119753..52119857 GGAACTGTACCAGGCGTGAA Chr7:52119790..52119809 61.1 55
downstream ENSMUSE00000472769 Chr7:52118905..52119102 CTCCGAGGAGTACAGGAGCA Chr7:52119009..52119028 60.54 60
downstream ENSMUSE00000462117 Chr7:52118439..52118814 GAAACATACAGGGGCAAGGA Chr7:52118438..52118457 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAACAAATTCTTGGCATGGA Chr7:52120304..52120324 59.52 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAACAAATTCTTGGCATGGA Chr7:52120304..52120324 59.52 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038502