Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10404
Trapped Gene
Rnaseh2b (ENSMUSG00000021932)
Vector Insertion
Chr 14: 62951014 - 62965404
Public Clones E047B02 (ggtc) D072E11 (ggtc) D072E11 (ggtc) E089E06 (ggtc) D068H12 (ggtc)
D110A06 (ggtc) D072E11 (ggtc) E089E06 (ggtc) D107D03 (ggtc) E130A03 (ggtc)
D068H12 (ggtc) CMHD-GT_374F12-3 (cmhd) IST14722H6 (tigm) IST11742F8 (tigm)
IST11696G3 (tigm) IST11742F8 (tigm)
Private Clones OST374317 (lexicon) OST371447 (lexicon) OST371402 (lexicon) OST370134 (lexicon)
OST357545 (lexicon) OST357497 (lexicon) OST338619 (lexicon) OST311909 (lexicon)
OST67611 (lexicon) OST60649 (lexicon) OST44555 (lexicon) OST42763 (lexicon)
OST41008 (lexicon) OST35582 (lexicon) OST32972 (lexicon) OST32559 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000445440 (Chr14:62950941..62951013 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAGGCAGCTAGTGTTCCTA Chr14:62950987..62951006 58.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000445440 (Chr14:62950941..62951013 +)
Downstram Exon
ENSMUSE00000122211 (Chr14:62965405..62965479 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAGGCAGCTAGTGTTCCTA Chr14:62950987..62951006 58.13 55 GCCAGCTTTACGAACAGGAG Chr14:62965468..62965487 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000445440 Chr14:62950941..62951013 CCAGGCAGCTAGTGTTCCTA Chr14:62950987..62951006 58.13 55

*** Putative Vector Insertion (Chr 14: 62951014 - 62965404) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000122211 Chr14:62965405..62965479 GCCAGCTTTACGAACAGGAG Chr14:62965468..62965487 60.01 55
downstream ENSMUSE00000445402 Chr14:62967358..62967465 No primer for this exon
downstream ENSMUSE00000122217 Chr14:62969237..62969313 CTCTTTGCCAGCCTTTAGGA Chr14:62969316..62969335 59.59 50
downstream ENSMUSE00000122213 Chr14:62972360..62972474 CATGCCGAAGTGACTTTTCA Chr14:62972462..62972481 59.84 45
downstream ENSMUSE00000445391 Chr14:62979300..62979364 TCTCCAGCCACTTCAATGTC Chr14:62979362..62979381 58.8 50
downstream ENSMUSE00000280565 Chr14:62980166..62980271 GGAAACCTGACCACCAGAGA Chr14:62980261..62980280 60.09 55
downstream ENSMUSE00000122206 Chr14:62982867..62982948 CATGGGCATAGCGAACATAA Chr14:62982893..62982912 59.54 45
downstream ENSMUSE00000122207 Chr14:62984096..62984138 AGGGTTGGTCAATGAAGCTG Chr14:62984132..62984151 60.11 50
downstream ENSMUSE00000122212 Chr14:62989309..62989389 TGCCGGTCTTCAAGTCTTTAG Chr14:62989389..62989409 59.5 47.62
downstream ENSMUSE00000336995 Chr14:62991197..62991337 CTGAGCTGCAGTCATTTTGC Chr14:62991226..62991245 59.75 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCACTCCTTTCTGCTTCCTG Chr14:62950984..62951004 59.98 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACTCCTTTCTGCTTCCTG Chr14:62950984..62951004 59.98 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021932