Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10405
Trapped Gene
Entpd6 (ENSMUSG00000033068)
Vector Insertion
Chr 2: 150574970 - 150578745
Public Clones D072E04 (ggtc) D072E04 (ggtc) D072E04 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000408363 (Chr2:150574885..150574969 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCTACGCCACTACCTCTCC Chr2:150574925..150574944 61.17 65 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000408363 (Chr2:150574885..150574969 +)
Downstram Exon
ENSMUSE00000390082 (Chr2:150578746..150579069 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCTACGCCACTACCTCTCC Chr2:150574925..150574944 61.17 65 GGATATGCCACCTTCGTCAT Chr2:150578833..150578852 59.78 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000408363 Chr2:150574885..150574969 GGCTACGCCACTACCTCTCC Chr2:150574925..150574944 61.17 65

*** Putative Vector Insertion (Chr 2: 150574970 - 150578745) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000390082 Chr2:150578746..150579069 GGATATGCCACCTTCGTCAT Chr2:150578833..150578852 59.78 50
downstream ENSMUSE00000287095 Chr2:150581779..150581855 AGGTTTCATGGGTCAAGGTG Chr2:150581808..150581827 59.82 50
downstream ENSMUSE00000287085 Chr2:150584479..150584622 GCAGCAACTTCTGAGCCTTT Chr2:150584620..150584639 59.76 50
downstream ENSMUSE00000287076 Chr2:150585839..150585914 AAGGGTGATGCCTTGAACAC Chr2:150585870..150585889 59.97 50
downstream ENSMUSE00000661438 Chr2:150586969..150587004 No primer for this exon
downstream ENSMUSE00000661437 Chr2:150588112..150588200 ACACGTGGGAGGAAAGTGAT Chr2:150588199..150588218 59.43 50
downstream ENSMUSE00000595354 Chr2:150589302..150589381 No primer for this exon
downstream ENSMUSE00000595353 Chr2:150589851..150589915 No primer for this exon
downstream ENSMUSE00000595352 Chr2:150591186..150591287 No primer for this exon
downstream ENSMUSE00000595351 Chr2:150592695..150592832 TAGAAGTCCACGTGCTGTGC Chr2:150592788..150592807 60.06 55
downstream ENSMUSE00000595350 Chr2:150594601..150594657 ACAAGGCTGCCTCCTTTCTC Chr2:150594628..150594647 60.9 55
downstream ENSMUSE00000595349 Chr2:150596028..150596140 TGTAGGTGAGGTCCATGCAG Chr2:150596093..150596112 59.7 55
downstream ENSMUSE00000595348 Chr2:150596365..150597409 TCAGGGCTGAGCTTTCTCAT Chr2:150597279..150597298 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGAGGACTGACTACGGTTG Chr2:150575001..150575021 60.7 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGGAGGACTGACTACGGTTG Chr2:150575001..150575021 60.7 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033068