Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10414
Trapped Gene
Gja1 (ENSMUSG00000050953)
Vector Insertion
Chr 10: 56097325 - 56107339
Public Clones P065G07 (ggtc) D032E05 (ggtc) D032E05 (ggtc) P115B02 (ggtc) D009H01 (ggtc)
D003H08 (ggtc) D177F01 (ggtc) D069A12 (ggtc) D003H08 (ggtc) IST11654B6 (tigm)
IST14278B2 (tigm) IST14207F10 (tigm)
Private Clones OST296639 (lexicon) OST114860 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000392576 (Chr10:56097136..56097324 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGAGCCCGAACTCTCCTTT Chr10:56097235..56097254 59.96 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000392576 (Chr10:56097136..56097324 +)
Downstram Exon
ENSMUSE00000430533 (Chr10:56107340..56110221 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGAGCCCGAACTCTCCTTT Chr10:56097235..56097254 59.96 55 GGACGTGAGAGGAAGCAGTC Chr10:56107963..56107982 59.99 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000392576 Chr10:56097136..56097324 GAGAGCCCGAACTCTCCTTT Chr10:56097235..56097254 59.96 55

*** Putative Vector Insertion (Chr 10: 56097325 - 56107339) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000430533 Chr10:56107340..56110221 GGACGTGAGAGGAAGCAGTC Chr10:56107963..56107982 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTAATCGCCTTGCAGCAC Chr10:56097373..56097393 61.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTCCCTTTTTGTTTATCAAGC Chr10:56097324..56097346 59.04 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050953