Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1042
Trapped Gene
Ranbp3 (ENSMUSG00000002372)
Vector Insertion
Chr 17: 56825427 - 56825485
Public Clones AY0347 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000693801 (Chr17:56825428..56825484 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000693801 (Chr17:56825428..56825484 +)
Downstram Exon
ENSMUSE00000427496 (Chr17:56825429..56825484 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000541491 Chr17:56812807..56812834 No primer for this exon
upstream ENSMUSE00000693802 Chr17:56824964..56824984 No primer for this exon

*** Putative Vector Insertion (Chr 17: 56825427 - 56825485) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000693801 Chr17:56825428..56825484 No primer for this exon
downstream ENSMUSE00000427496 Chr17:56825429..56825484 No primer for this exon
downstream ENSMUSE00000427470 Chr17:56836025..56836061 No primer for this exon
downstream ENSMUSE00000427464 Chr17:56836141..56836212 No primer for this exon
downstream ENSMUSE00000427456 Chr17:56840446..56840511 No primer for this exon
downstream ENSMUSE00000427445 Chr17:56840872..56840964 No primer for this exon
downstream ENSMUSE00000427442 Chr17:56842186..56842313 No primer for this exon
downstream ENSMUSE00000378834 Chr17:56844880..56844993 No primer for this exon
downstream ENSMUSE00000139663 Chr17:56846285..56846388 No primer for this exon
downstream ENSMUSE00000139654 Chr17:56846586..56846661 No primer for this exon
downstream ENSMUSE00000139650 Chr17:56847274..56847376 No primer for this exon
downstream ENSMUSE00000139661 Chr17:56847594..56847703 No primer for this exon
downstream ENSMUSE00000139655 Chr17:56848637..56848757 No primer for this exon
downstream ENSMUSE00000139649 Chr17:56849511..56849653 No primer for this exon
downstream ENSMUSE00000139659 Chr17:56850014..56850200 No primer for this exon
downstream ENSMUSE00000139657 Chr17:56850279..56851184 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGTAATCGCCTTGCAGCAC Chr17:56825475..56825495 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAAGCGTGACTGGGAAAAC Chr17:56825473..56825493 60.67 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002372