Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10427
Trapped Gene
Spag7 (ENSMUSG00000018287)
Vector Insertion
Chr 11: 70478867 - 70482698
Public Clones (sanger) (sanger) 5SD065F05 (ggtc) (ggtc) E130F04 (ggtc) 3SD113C04 (ggtc)
A071E03 (ggtc) (ggtc) 3SD065F05 (ggtc) (ggtc) D113B03 (ggtc)
(ggtc) A054F07 (ggtc) (ggtc) 5SD113C04 (ggtc) D065F05 (ggtc)
(ggtc) CMHD-GT_330E8-3 (cmhd) FHCRC-GT-S20-8A1 (fhcrc) PST4932-NL (escells)
IST10010C4 (tigm) IST13104G4 (tigm) IST14903A3 (tigm)
Private Clones OST393834 (lexicon) OST198755 (lexicon)
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000383802 (Chr11:70482699..70482795 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000383802 (Chr11:70482699..70482795 -)
Downstram Exon
ENSMUSE00000109641 (Chr11:70478799..70478866 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000383802 Chr11:70482699..70482795 No primer for this exon

*** Putative Vector Insertion (Chr 11: 70478867 - 70482698) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000109641 Chr11:70478799..70478866 No primer for this exon
downstream ENSMUSE00000109648 Chr11:70478490..70478578 No primer for this exon
downstream ENSMUSE00000109644 Chr11:70478285..70478369 No primer for this exon
downstream ENSMUSE00000109637 Chr11:70478080..70478169 No primer for this exon
downstream ENSMUSE00000109645 Chr11:70477822..70477978 No primer for this exon
downstream ENSMUSE00000374986 Chr11:70477292..70477722 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTATCTTCGCCCGATTCTTG Chr11:70479652..70479672 59.67 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGTGAGGATCCCAGATTCA Chr11:70482679..70482699 59.46 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCGTCCTTCCCTTTAAGACG Chr11:70482809..70482829 59.31 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCGTCCTTCCCTTTAAGACG Chr11:70482809..70482829 59.31 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018287