Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1043
Trapped Gene
Ccdc55 (ENSMUSG00000037958)
Vector Insertion
Chr 11: 76868503 - 76890155
Public Clones AY0346 (sanger) AD0334 (sanger) (sanger) RRM132 (baygenomics) IST10406A2 (tigm)
IST11548E8 (tigm) IST10843D10 (tigm) IST15061G7 (tigm)
Private Clones OST462387 (lexicon) OST458278 (lexicon) OST401559 (lexicon) OST389206 (lexicon)
OST333155 (lexicon) OST200724 (lexicon) OST85770 (lexicon) OST85762 (lexicon)
OST59856 (lexicon) OST58385 (lexicon) OST54791 (lexicon) OST54787 (lexicon)
OST44647 (lexicon) OST38047 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000661750 (Chr11:76890156..76890246 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTTGCACCGAGTTTTACAG Chr11:76890195..76890214 59.39 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000661750 (Chr11:76890156..76890246 -)
Downstram Exon
ENSMUSE00000293705 (Chr11:76868446..76868502 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTTGCACCGAGTTTTACAG Chr11:76890195..76890214 59.39 50 CTCTGAAGGCTTTCGCTCAC Chr11:76868455..76868474 60.28 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661751 Chr11:76891881..76891937 AGCGGAGACGGGAACAAGAT Chr11:76891899..76891918 63.34 55
upstream ENSMUSE00000661750 Chr11:76890156..76890246 CGTTGCACCGAGTTTTACAG Chr11:76890195..76890214 59.39 50

*** Putative Vector Insertion (Chr 11: 76868503 - 76890155) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000293705 Chr11:76868446..76868502 CTCTGAAGGCTTTCGCTCAC Chr11:76868455..76868474 60.28 55
downstream ENSMUSE00000293697 Chr11:76864086..76864214 GCTTGGGGTTGTTTTCTTCC Chr11:76864087..76864106 60.84 50
downstream ENSMUSE00000293687 Chr11:76862775..76862982 TCCGTTTTCCATCTCTCGTT Chr11:76862856..76862875 59.67 45
downstream ENSMUSE00000293678 Chr11:76861855..76861963 TCTGCTTGGTCACATCCAAA Chr11:76861918..76861937 60.24 45
downstream ENSMUSE00000661749 Chr11:76857794..76860256 GGCCTCTCTGTGCCTATGAG Chr11:76859823..76859842 59.97 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGCCCCATGATTAACTTT Chr11:76884121..76884141 59.05 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGTCATACGTGACTGGGAAAA Chr11:76884090..76884111 60.93 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CACCTTTTCTTGCACACAGC Chr11:76884221..76884241 59.49 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGTTTGATTCCTTGCCGTGA Chr11:76884191..76884211 60.64 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037958