Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10430
Trapped Gene
Eif2c1 (ENSMUSG00000041530)
Vector Insertion
Chr 4: 126139050 - 126140915
Public Clones D065D10 (ggtc) D065D10 (ggtc) IST14941A8 (tigm)
Private Clones OST226013 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000338399 (Chr4:126140916..126141099 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAAGCCGGATAAGTGTCCT Chr4:126140930..126140949 59.69 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000338399 (Chr4:126140916..126141099 -)
Downstram Exon
ENSMUSE00000224186 (Chr4:126138929..126139049 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAAGCCGGATAAGTGTCCT Chr4:126140930..126140949 59.69 50 AGATCTGCGGTTTGAAATGC Chr4:126138984..126139003 60.22 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000368555 Chr4:126145641..126145878 CTCACGCTGGACTCCTCAGT Chr4:126145701..126145720 60.61 60
upstream ENSMUSE00000338399 Chr4:126140916..126141099 TCAAGCCGGATAAGTGTCCT Chr4:126140930..126140949 59.69 50

*** Putative Vector Insertion (Chr 4: 126139050 - 126140915) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000224186 Chr4:126138929..126139049 AGATCTGCGGTTTGAAATGC Chr4:126138984..126139003 60.22 45
downstream ENSMUSE00000224178 Chr4:126138150..126138331 ATAGATGCCAGGTGCCTCAT Chr4:126138131..126138150 59.54 50
downstream ENSMUSE00000224170 Chr4:126137611..126137747 CAGACTGGTGAAAGCCGAAC Chr4:126137628..126137647 60.83 55
downstream ENSMUSE00000342961 Chr4:126137245..126137379 TTGTAGAAGGCAGTGGCTGA Chr4:126137336..126137355 59.59 50
downstream ENSMUSE00000394898 Chr4:126137024..126137111 CACACGCGGTATTTCCTCTT Chr4:126137035..126137054 60.13 50
downstream ENSMUSE00000360501 Chr4:126136353..126136500 TCGAGGGGCAAATAGGTATG Chr4:126136332..126136351 59.92 50
downstream ENSMUSE00000228456 Chr4:126131549..126131668 CCCAGCCACAATGTTACAGA Chr4:126131626..126131645 59.57 50
downstream ENSMUSE00000372685 Chr4:126131070..126131192 CTCCGTCATGTCATCCTTCA Chr4:126131096..126131115 59.63 50
downstream ENSMUSE00000365915 Chr4:126130802..126130935 TGAGCACCTCTTCTCGACAC Chr4:126130781..126130800 59.13 55
downstream ENSMUSE00000341143 Chr4:126126011..126126195 AATCTTCCGAAGCTGGTCTG Chr4:126126146..126126165 59.43 50
downstream ENSMUSE00000369122 Chr4:126120325..126120484 CTCCGACACGTTTCACTTCA Chr4:126120442..126120461 59.87 50
downstream ENSMUSE00000234783 Chr4:126120060..126120150 TCTGCTCCCAGGAAAATCAC Chr4:126120087..126120106 60.19 50
downstream ENSMUSE00000234774 Chr4:126119133..126119327 GAAGCGGGTGGACTTGTAGA Chr4:126119168..126119187 60.26 55
downstream ENSMUSE00000234766 Chr4:126118421..126118555 GGCAAGCAGCTCATAGTGAA Chr4:126118510..126118529 59.18 50
downstream ENSMUSE00000377612 Chr4:126117608..126117709 GGTGATGTTGGTGTCCACAG Chr4:126117634..126117653 59.85 55
downstream ENSMUSE00000524941 Chr4:126117086..126117285 AAACGGTTGTCATCCCAAAG Chr4:126117214..126117233 59.83 45
downstream ENSMUSE00000631261 Chr4:126112256..126116855 GTGTTACGAGGGCTGGATGT Chr4:126116060..126116079 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr4:126140845..126140865 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAAACGTGACTGGGAAAAC Chr4:126140849..126140869 59.43 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTGGCGTCTTTGTCTTCACA Chr4:126141099..126141119 59.88 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTGGCGTCTTTGTCTTCACA Chr4:126141099..126141119 59.88 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041530