Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10432
Trapped Gene
Gigyf2 (ENSMUSG00000048000)
Vector Insertion
Chr 1: 89223668 - 89230844
Public Clones 3SD041H10 (ggtc) D065B12 (ggtc) 3SP094F04 (ggtc) P088F10 (ggtc)
5SD065B12 (ggtc) 3SP134D02 (ggtc) D044B07 (ggtc) (ggtc)
D089E05 (ggtc) 5SD041H10 (ggtc) 5SP094F04 (ggtc) D014A09 (ggtc)
CMHD-GT_264G02-3 (cmhd)
Private Clones OST453083 (lexicon) OST346678 (lexicon) OST283522 (lexicon) OST270943 (lexicon)
OST262912 (lexicon) OST223639 (lexicon) OST194045 (lexicon) OST146959 (lexicon)
OST143855 (lexicon) OST122648 (lexicon) OST43067 (lexicon) OST38222 (lexicon)
OST38221 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000510582 (Chr1:89223617..89223667 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGCTGAGGATTGACTTGG Chr1:89223618..89223637 59.8 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000510582 (Chr1:89223617..89223667 +)
Downstram Exon
ENSMUSE00000453040 (Chr1:89230845..89230909 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGCTGAGGATTGACTTGG Chr1:89223618..89223637 59.8 55 CACAGCAAGAGGTTTCAGCA Chr1:89230890..89230909 60.17 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000510582 Chr1:89223617..89223667 GAGGCTGAGGATTGACTTGG Chr1:89223618..89223637 59.8 55

*** Putative Vector Insertion (Chr 1: 89223668 - 89230844) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000453040 Chr1:89230845..89230909 CACAGCAAGAGGTTTCAGCA Chr1:89230890..89230909 60.17 50
downstream ENSMUSE00000453004 Chr1:89250979..89251061 GCTGCCATTCTTCTCCGTAT Chr1:89251031..89251050 59.3 50
downstream ENSMUSE00000453001 Chr1:89260679..89260808 GGACGTGATACTCCCACCAC Chr1:89260718..89260737 60.25 60
downstream ENSMUSE00000452989 Chr1:89261759..89261854 CTAGAGCCAATGGTGGCAAG Chr1:89261834..89261853 60.79 55
downstream ENSMUSE00000452983 Chr1:89270572..89270686 TCCTCCTCGTCCTGTCAATC Chr1:89270634..89270653 60.2 55
downstream ENSMUSE00000452975 Chr1:89275547..89275658 GCCCAAACACACCCTCTACT Chr1:89275615..89275634 59.06 55
downstream ENSMUSE00000452970 Chr1:89276543..89276583 GTTTTTCAAAGCGCCTGTCA Chr1:89276568..89276587 61.31 45
downstream ENSMUSE00000452964 Chr1:89300242..89300421 CAGACGTTGGTCCACTTTCC Chr1:89300280..89300299 60.54 55
downstream ENSMUSE00000452951 Chr1:89303559..89303776 GTCAAACGTGCCCATTTCTT Chr1:89303752..89303771 59.98 45
downstream ENSMUSE00000629285 Chr1:89303577..89303776 GTCAAACGTGCCCATTTCTT Chr1:89303752..89303771 59.98 45
downstream ENSMUSE00000452946 Chr1:89303868..89304030 CTTTGGCCTCTTCGTTATGG Chr1:89303979..89303998 59.7 50
downstream ENSMUSE00000452937 Chr1:89304110..89304298 GGCTTCTTGAGGCTGATGAT Chr1:89304192..89304211 59.39 50
downstream ENSMUSE00000452928 Chr1:89307237..89307433 AGTAGGAACAGGAGGCGACA Chr1:89307328..89307347 59.87 55
downstream ENSMUSE00000365871 Chr1:89308283..89308442 CATGCATCAGTGGGATTGAC Chr1:89308397..89308416 59.92 50
downstream ENSMUSE00000326310 Chr1:89313393..89313559 TGGAAGCTTTCATCACATGC Chr1:89313489..89313508 59.81 45
downstream ENSMUSE00000326303 Chr1:89315663..89315754 AGGCAGTGAGTTCCTGCTGT Chr1:89315714..89315733 60.06 55
downstream ENSMUSE00000326296 Chr1:89316860..89316967 CTGCTGTTGAGCCAAAACCT Chr1:89316896..89316915 60.43 50
downstream ENSMUSE00000452876 Chr1:89318066..89318166 GGCTGAAGCTCCCAGATAGA Chr1:89318149..89318168 59.53 55
downstream ENSMUSE00000452870 Chr1:89319756..89319856 TAGCTGCTGAAGCTGTTCCA Chr1:89319838..89319857 59.89 50
downstream ENSMUSE00000709702 Chr1:89321640..89321801 CCTCTTTCGCTCCTCCTCTT Chr1:89321705..89321724 60.09 55
downstream ENSMUSE00000720151 Chr1:89321640..89321801 CCTCTTTCGCTCCTCCTCTT Chr1:89321705..89321724 60.09 55
downstream ENSMUSE00000452857 Chr1:89325145..89325303 CGCTCCTCCAATCGTCTAAG Chr1:89325254..89325273 59.97 55
downstream ENSMUSE00000629283 Chr1:89325145..89325303 CGCTCCTCCAATCGTCTAAG Chr1:89325254..89325273 59.97 55
downstream ENSMUSE00000394316 Chr1:89330255..89330491 AGCTCCAATTCCTTCCGTTT Chr1:89330394..89330413 60.07 45
downstream ENSMUSE00000629282 Chr1:89330255..89330491 AGCTCCAATTCCTTCCGTTT Chr1:89330394..89330413 60.07 45
downstream ENSMUSE00000390720 Chr1:89333344..89333466 No primer for this exon
downstream ENSMUSE00000629281 Chr1:89333344..89333466 No primer for this exon
downstream ENSMUSE00000403228 Chr1:89336963..89337187 GGCTCTGTTTGATTGCTGGT Chr1:89337178..89337197 60.26 50
downstream ENSMUSE00000629280 Chr1:89336963..89337187 GGCTCTGTTTGATTGCTGGT Chr1:89337178..89337197 60.26 50
downstream ENSMUSE00000357149 Chr1:89337292..89337497 GCTGGTATGCAGGTTGGAAT Chr1:89337315..89337334 59.96 50
downstream ENSMUSE00000629279 Chr1:89337292..89337497 GCTGGTATGCAGGTTGGAAT Chr1:89337315..89337334 59.96 50
downstream ENSMUSE00000157365 Chr1:89338586..89338740 TCTGCCGGTTAGACACACCT Chr1:89338617..89338636 60.71 55
downstream ENSMUSE00000629278 Chr1:89338586..89338740 TCTGCCGGTTAGACACACCT Chr1:89338617..89338636 60.71 55
downstream ENSMUSE00000373135 Chr1:89340220..89340401 ACGCTGCTGGTTGACTTTCT Chr1:89340374..89340393 60.06 50
downstream ENSMUSE00000629277 Chr1:89340220..89340401 ACGCTGCTGGTTGACTTTCT Chr1:89340374..89340393 60.06 50
downstream ENSMUSE00000157369 Chr1:89342887..89343034 GCTCGAACCATCTTCTGCTT Chr1:89343020..89343039 59.58 50
downstream ENSMUSE00000629276 Chr1:89342887..89343034 GCTCGAACCATCTTCTGCTT Chr1:89343020..89343039 59.58 50
downstream ENSMUSE00000381432 Chr1:89345653..89347347 GGGCTGGTCCACTAGGTACA Chr1:89345935..89345954 59.99 60
downstream ENSMUSE00000629275 Chr1:89345653..89347347 GGGCTGGTCCACTAGGTACA Chr1:89345935..89345954 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTTCTCAGGCACTGGTGAT Chr1:89229699..89229719 59.26 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTTCTCAGGCACTGGTGAT Chr1:89229699..89229719 59.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048000