Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10434
Trapped Gene
Mllt4 (ENSMUSG00000068036)
Vector Insertion
Chr 17: 13972364 - 13983278
Public Clones D063G04 (ggtc) D063G04 (ggtc) D058E05 (ggtc) D063G04 (ggtc) Q022C01 (ggtc)
D058E05 (ggtc) IST13122B6 (tigm) IST11919H1 (tigm) IST12615B6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000433614 (Chr17:13972245..13972363 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGCAGGAATATCGACGAC Chr17:13972334..13972353 59.66 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000433614 (Chr17:13972245..13972363 +)
Downstram Exon
ENSMUSE00000433610 (Chr17:13983279..13983340 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGCAGGAATATCGACGAC Chr17:13972334..13972353 59.66 55 GCTGGCAGGCAGTATCAGTT Chr17:13983324..13983343 60.43 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000703721 Chr17:13898612..13899010 GACTTAATTTTGCCGGTGGA Chr17:13898895..13898914 59.94 45
upstream ENSMUSE00000242801 Chr17:13940946..13941141 TAGCACAGCCACCACTCAAG Chr17:13941029..13941048 60.05 55
upstream ENSMUSE00000136121 Chr17:13944284..13944399 ATGATCGAGAGGGTCGATTC Chr17:13944344..13944363 59.05 50
upstream ENSMUSE00000136125 Chr17:13945939..13946102 AATGGACCTGAAAAGCAGGA Chr17:13945951..13945970 59.67 45
upstream ENSMUSE00000403483 Chr17:13947417..13947577 GAGTTTCGGAGCTCAGATGG Chr17:13947544..13947563 59.95 55
upstream ENSMUSE00000433661 Chr17:13955128..13955285 GCTGTAGCCGAATCTTTGGA Chr17:13955217..13955236 60.35 50
upstream ENSMUSE00000480607 Chr17:13959273..13959384 GGAATGGCCAAGTGACAAAG Chr17:13959365..13959384 60.49 50
upstream ENSMUSE00000513922 Chr17:13960298..13960465 GAGGAGACCACCGGACTACA Chr17:13960320..13960339 60.11 60
upstream ENSMUSE00000433633 Chr17:13965936..13966030 CCGCCTTCAATTAAGTGTGAC Chr17:13965970..13965990 59.62 47.62
upstream ENSMUSE00000433627 Chr17:13966877..13967139 TGCAGAGACCTACGTGGATG Chr17:13966960..13966979 59.85 55
upstream ENSMUSE00000433619 Chr17:13969375..13969444 TGGGAGGAGATGTCCACAGT Chr17:13969401..13969420 60.53 55
upstream ENSMUSE00000433614 Chr17:13972245..13972363 GGAGCAGGAATATCGACGAC Chr17:13972334..13972353 59.66 55

*** Putative Vector Insertion (Chr 17: 13972364 - 13983278) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000433610 Chr17:13983279..13983340 GCTGGCAGGCAGTATCAGTT Chr17:13983324..13983343 60.43 55
downstream ENSMUSE00000433604 Chr17:13983441..13983646 TGGCTGGACAATACATACCG Chr17:13983558..13983577 59.42 50
downstream ENSMUSE00000433599 Chr17:13986115..13986260 CGACTAAGGTCTCGGTCCTG Chr17:13986209..13986228 59.86 60
downstream ENSMUSE00000433594 Chr17:13986575..13986669 CCAGAAAGGCTGGCATGTAG Chr17:13986633..13986652 60.79 55
downstream ENSMUSE00000433589 Chr17:13987787..13988052 GAAGAGCTGGATGGTCAAGG Chr17:13987872..13987891 59.8 55
downstream ENSMUSE00000433583 Chr17:13989323..13989466 ATCGGGTGCACAGTGGTAAT Chr17:13989451..13989470 60.26 50
downstream ENSMUSE00000703720 Chr17:13990927..13990941 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCGACGACGAGAAAACAGG Chr17:13972346..13972366 60.26 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCGACGACGAGAAAACAGG Chr17:13972346..13972366 60.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000068036