Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10437
Trapped Gene
A630089N07Rik (ENSMUSG00000074887)
Vector Insertion
Chr 16: 98288310 - 98288919
Public Clones D063E07 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000641757 (Chr16:98288920..98288980 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000641757 (Chr16:98288920..98288980 -)
Downstram Exon
ENSMUSE00000696802 (Chr16:98288305..98288309 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696803 Chr16:98303055..98303132 ATGCTGTGGATTGTGCTCAG Chr16:98303078..98303097 59.86 50
upstream ENSMUSE00000641758 Chr16:98289169..98289295 CTCGTGAAGAATGGGCTTTG Chr16:98289239..98289258 60.77 50
upstream ENSMUSE00000641757 Chr16:98288920..98288980 No primer for this exon

*** Putative Vector Insertion (Chr 16: 98288310 - 98288919) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000696802 Chr16:98288305..98288309 No primer for this exon
downstream ENSMUSE00000696800 Chr16:98288184..98288191 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000074887