Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10439
Trapped Gene
9030409G11Rik (ENSMUSG00000040606)
Vector Insertion
Chr 4: 141766128 - 141794899
Public Clones D063D08 (ggtc) D063F08 (ggtc) (ggtc) D063D08 (ggtc) D063F08 (ggtc)
D063D08 (ggtc) (ggtc) IST13077E9 (tigm) IST14780A6 (tigm) IST14784A6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000410441 (Chr4:141794900..141795316 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGCTATGCGCGGACACTAC Chr4:141794968..141794987 60.44 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000410441 (Chr4:141794900..141795316 -)
Downstram Exon
ENSMUSE00000524363 (Chr4:141765930..141766127 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGCTATGCGCGGACACTAC Chr4:141794968..141794987 60.44 55 GGTGCACTTCCTCTTGAAGC Chr4:141766055..141766074 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000410441 Chr4:141794900..141795316 AAGCTATGCGCGGACACTAC Chr4:141794968..141794987 60.44 55

*** Putative Vector Insertion (Chr 4: 141766128 - 141794899) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000370854 Chr4:141765930..141766121 GGTGCACTTCCTCTTGAAGC Chr4:141766055..141766074 60 55
downstream ENSMUSE00000524363 Chr4:141765930..141766127 GGTGCACTTCCTCTTGAAGC Chr4:141766055..141766074 60 55
downstream ENSMUSE00000596110 Chr4:141714959..141715095 CTGCTCATAGTTGCGGATGA Chr4:141714946..141714965 59.97 50
downstream ENSMUSE00000596112 Chr4:141714959..141715095 CTGCTCATAGTTGCGGATGA Chr4:141714946..141714965 59.97 50
downstream ENSMUSE00000596109 Chr4:141710345..141710515 GTGCTTTGACTGCGTCTTCA Chr4:141710469..141710488 60.18 50
downstream ENSMUSE00000596111 Chr4:141710345..141710515 GTGCTTTGACTGCGTCTTCA Chr4:141710469..141710488 60.18 50
downstream ENSMUSE00000305891 Chr4:141706761..141706950 GGGAGGGTGTGAGTGGTAGA Chr4:141706758..141706777 59.96 60
downstream ENSMUSE00000411530 Chr4:141702933..141703060 GTCTTGGGGAGTTGATGTCG Chr4:141702934..141702953 60.51 55
downstream ENSMUSE00000305878 Chr4:141699209..141699259 AGGGTTGTGTAGGCTCTTCTGA Chr4:141699196..141699217 60.3 50
downstream ENSMUSE00000510231 Chr4:141697588..141697711 CTGGCGAAGACTCGAGAGAT Chr4:141697607..141697626 59.7 55
downstream ENSMUSE00000510247 Chr4:141695159..141697711 ACCTTACCCTGACGACGATG Chr4:141696853..141696872 59.99 55
downstream ENSMUSE00000454698 Chr4:141673990..141674195 TCTGCTCCTCTCCCTCAGAC Chr4:141674111..141674130 59.66 60
downstream ENSMUSE00000454690 Chr4:141673000..141673118 GCCTCAGCATCTCGGTAGTC Chr4:141672987..141673006 59.98 60
downstream ENSMUSE00000454683 Chr4:141668023..141668254 GTCCCGCTTCATCAGTGAAT Chr4:141668094..141668113 60.08 50
downstream ENSMUSE00000454676 Chr4:141665192..141665293 No primer for this exon
downstream ENSMUSE00000454670 Chr4:141664461..141664627 GACACCGCTATTGGTCAGGT Chr4:141664573..141664592 60 55
downstream ENSMUSE00000454661 Chr4:141662727..141662841 CCAGCTCTGGTGATGCTAGA Chr4:141662748..141662767 59.14 55
downstream ENSMUSE00000454654 Chr4:141658306..141660869 GGACTCAGGGAATCCTCCTC Chr4:141659251..141659270 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGACAGGGGATTTCTCAAG Chr4:141785863..141785883 60.82 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGACAGGGGATTTCTCAAG Chr4:141785863..141785883 60.82 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTGCTCTCTCCCTTGACAGG Chr4:141786337..141786357 60.13 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTGCTCTCTCCCTTGACAGG Chr4:141786337..141786357 60.13 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040606