Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10441
Trapped Gene
Nf2 (ENSMUSG00000009073)
Vector Insertion
Chr 11: 4703757 - 4706256
Public Clones (sanger) (sanger) (sanger) E053A08 (ggtc) D080B08 (ggtc) D139B05 (ggtc)
E120A06 (ggtc) D117F11 (ggtc) E025E05 (ggtc) D062G04 (ggtc) D062G04 (ggtc)
D139B05 (ggtc) (ggtc) E089F08 (ggtc) D080B08 (ggtc) D166G03 (ggtc)
D062G04 (ggtc) D117F11 (ggtc) CMHD-GT_517F2-3 (cmhd) CMHD-GT_410D1-3 (cmhd)
(cmhd) CMHD-GT_503H5-3 (cmhd) CMHD-GT_517F2-5S (cmhd) CMHD-GT_269B7-3 (cmhd)
PST12743-NL (escells) IST12536A4 (tigm) IST13217G1 (tigm) IST12536A4 (tigm)
Private Clones OST465038 (lexicon) OST439430 (lexicon) OST432995 (lexicon) OST430152 (lexicon)
OST420282 (lexicon) OST406480 (lexicon) OST327258 (lexicon) OST271147 (lexicon)
OST261198 (lexicon) OST252894 (lexicon) OST236628 (lexicon) OST208608 (lexicon)
OST208353 (lexicon) OST200138 (lexicon) OST130282 (lexicon) OST112460 (lexicon)
OST84129 (lexicon)
Severity of mutation (?) Insertion after 57% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000104227 (Chr11:4706257..4706339 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000104227 (Chr11:4706257..4706339 -)
Downstram Exon
ENSMUSE00000104225 (Chr11:4703681..4703756 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000456636 Chr11:4748875..4748988 No primer for this exon
upstream ENSMUSE00000581392 Chr11:4748875..4749368 No primer for this exon
upstream ENSMUSE00000710927 Chr11:4748875..4749530 No primer for this exon
upstream ENSMUSE00000712691 Chr11:4748875..4749530 No primer for this exon
upstream ENSMUSE00000682067 Chr11:4733001..4733136 No primer for this exon
upstream ENSMUSE00000656076 Chr11:4720371..4720496 No primer for this exon
upstream ENSMUSE00000656088 Chr11:4720371..4720496 No primer for this exon
upstream ENSMUSE00000104218 Chr11:4718508..4718630 No primer for this exon
upstream ENSMUSE00000104220 Chr11:4716085..4716168 No primer for this exon
upstream ENSMUSE00000104229 Chr11:4708260..4708328 No primer for this exon
upstream ENSMUSE00000104227 Chr11:4706257..4706339 No primer for this exon

*** Putative Vector Insertion (Chr 11: 4703757 - 4706256) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000104225 Chr11:4703681..4703756 No primer for this exon
downstream ENSMUSE00000104215 Chr11:4699864..4699998 No primer for this exon
downstream ENSMUSE00000308293 Chr11:4694846..4694920 No primer for this exon
downstream ENSMUSE00000104231 Chr11:4694415..4694528 No primer for this exon
downstream ENSMUSE00000709587 Chr11:4691094..4691216 No primer for this exon
downstream ENSMUSE00000711364 Chr11:4691094..4691216 No primer for this exon
downstream ENSMUSE00000104239 Chr11:4689668..4689885 No primer for this exon
downstream ENSMUSE00000682063 Chr11:4689668..4689885 No primer for this exon
downstream ENSMUSE00000104236 Chr11:4687447..4687552 No primer for this exon
downstream ENSMUSE00000682061 Chr11:4687447..4687552 No primer for this exon
downstream ENSMUSE00000104222 Chr11:4684439..4684566 No primer for this exon
downstream ENSMUSE00000682059 Chr11:4684439..4684566 No primer for this exon
downstream ENSMUSE00000308256 Chr11:4682190..4682355 No primer for this exon
downstream ENSMUSE00000682057 Chr11:4682190..4682355 No primer for this exon
downstream ENSMUSE00000682066 Chr11:4681940..4682355 No primer for this exon
downstream ENSMUSE00000682080 Chr11:4680590..4680625 No primer for this exon
downstream ENSMUSE00000682077 Chr11:4680581..4680625 No primer for this exon
downstream ENSMUSE00000682068 Chr11:4672337..4672641 No primer for this exon
downstream ENSMUSE00000581387 Chr11:4667668..4668276 No primer for this exon
downstream ENSMUSE00000581399 Chr11:4665851..4668276 No primer for this exon
downstream ENSMUSE00000682054 Chr11:4665851..4668276 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATGCCTCCTCCCCTACTAA Chr11:4706202..4706222 59.15 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTACCGTGACTGGGAAAAC Chr11:4706190..4706210 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTTTGCATGTGGGCTTTTCT Chr11:4706356..4706376 60.25 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTTTGCATGTGGGCTTTTCT Chr11:4706356..4706376 60.25 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000009073