Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10457
Trapped Gene
Banf1 (ENSMUSG00000024844)
Vector Insertion
Chr 19: 5365957 - 5366567
Public Clones (sanger) P063A07 (ggtc) P133A02 (ggtc) D055G04 (ggtc) D038D06 (ggtc)
D038D06 (ggtc) PST11216-NR (escells) PSTVU01.F35 (vanderbilt)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000384820 (Chr19:5366568..5366631 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000384820 (Chr19:5366568..5366631 -)
Downstram Exon
ENSMUSE00000145472 (Chr19:5365818..5365956 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CACGAAGTCTCGGTGCTTTT Chr19:5365886..5365905 60.43 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000384820 Chr19:5366568..5366631 No primer for this exon

*** Putative Vector Insertion (Chr 19: 5365957 - 5366567) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000145472 Chr19:5365818..5365956 CACGAAGTCTCGGTGCTTTT Chr19:5365886..5365905 60.43 50
downstream ENSMUSE00000413957 Chr19:5364641..5365158 AGGGGAGAGAACTCCCCATA Chr19:5364837..5364856 59.89 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr19:5366497..5366517 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGAGAAGCGGAGTGGTGCT Chr19:5366540..5366560 62.92 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGAACCGTCTCGTAGCTTGA Chr19:5366624..5366644 60.4 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AACCGTCTCGTAGCTTGAGG Chr19:5366622..5366642 59.5 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024844