Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10463
Trapped Gene
Foxk1 (ENSMUSG00000056493)
Vector Insertion
Chr 5: 142911281 - 142924640
Public Clones (sanger) (sanger) (sanger) (sanger) D054F10 (ggtc) D054F10 (ggtc)
E326F03 (ggtc) D054F10 (ggtc) D156B09 (ggtc) IST14060C8 (tigm) IST14060C8 (tigm)
Private Clones OST329320 (lexicon) OST54309 (lexicon) OST30022 (lexicon)
Severity of mutation (?) Insertion after 33% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000474194 (Chr5:142911095..142911280 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCCCACTGAAGATCCACAT Chr5:142911201..142911220 60.33 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000474194 (Chr5:142911095..142911280 +)
Downstram Exon
ENSMUSE00000590045 (Chr5:142924641..142924797 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCCCACTGAAGATCCACAT Chr5:142911201..142911220 60.33 50 AGGTCGGAGGTCACATTCTG Chr5:142924724..142924743 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000590046 Chr5:142877451..142877995 GGAGTTCGAGTTCCTGATGC Chr5:142877771..142877790 59.81 55
upstream ENSMUSE00000474194 Chr5:142911095..142911280 TCCCCACTGAAGATCCACAT Chr5:142911201..142911220 60.33 50

*** Putative Vector Insertion (Chr 5: 142911281 - 142924640) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000590045 Chr5:142924641..142924797 AGGTCGGAGGTCACATTCTG Chr5:142924724..142924743 60.11 55
downstream ENSMUSE00000534632 Chr5:142926195..142926341 GATCAGCTGCGCATAGGAGT Chr5:142926236..142926255 60.53 55
downstream ENSMUSE00000473425 Chr5:142927393..142927586 CAGGGTCTATTCGCCAAAAA Chr5:142927495..142927514 60.07 45
downstream ENSMUSE00000472392 Chr5:142929463..142929629 TGGGAATAGCGGTACTCTGG Chr5:142929621..142929640 60.09 55
downstream ENSMUSE00000509938 Chr5:142929714..142929998 GATGTACCCGTTGGCTGAGT Chr5:142929922..142929941 60 55
downstream ENSMUSE00000590040 Chr5:142931307..142931531 GGTACAGCGTGCTTTCCATT Chr5:142931505..142931524 60.14 50
downstream ENSMUSE00000590039 Chr5:142932430..142937968 AGCAGGCCCTTCTAGTCCTC Chr5:142936831..142936850 59.98 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGACTCTCTGTGTAGCCAAG Chr5:142923261..142923282 60.06 57.14 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGGACTCTCTGTGTAGCCAAG Chr5:142923261..142923282 60.06 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056493