Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10464
Trapped Gene
Uty (ENSMUSG00000068457)
Vector Insertion
Chr Y: 560990 - 576153
Public Clones D054F08 (ggtc) (ggtc) IST10387E8 (tigm) IST12212H8HMR1 (tigm) IST13682G9 (tigm)
IST14541A4 (tigm) IST10409F5 (tigm) IST10294C5 (tigm) IST12685B11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000626518 (ChrY:576154..576262 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGAAGGAAAAGTGGAATCAG ChrY:576208..576229 60.24 45.46 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000626518 (ChrY:576154..576262 -)
Downstram Exon
ENSMUSE00000626517 (ChrY:560940..560989 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGAAGGAAAAGTGGAATCAG ChrY:576208..576229 60.24 45.46 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000577901 ChrY:581850..582181 GAAGGCGCTTTGTGGATTAG ChrY:581854..581873 59.85 50
upstream ENSMUSE00000626519 ChrY:581599..581662 CAGCTTCTTCGGGTTCTTGA ChrY:581643..581662 60.51 50
upstream ENSMUSE00000626518 ChrY:576154..576262 GCTGAAGGAAAAGTGGAATCAG ChrY:576208..576229 60.24 45.46

*** Putative Vector Insertion (Chr Y: 560990 - 576153) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000626517 ChrY:560940..560989 No primer for this exon
downstream ENSMUSE00000626516 ChrY:535898..535956 No primer for this exon
downstream ENSMUSE00000626515 ChrY:533649..533769 TGGCTCTGCAAAAATTAGGG ChrY:533692..533711 60.2 45
downstream ENSMUSE00000626514 ChrY:525779..525833 GATCAGGGCCAGCTGAAAAT ChrY:525791..525810 61.49 50
downstream ENSMUSE00000626513 ChrY:523217..523251 No primer for this exon
downstream ENSMUSE00000626512 ChrY:512934..513027 ATAGGCTGCCTTTGCAGAAT ChrY:512976..512995 58.96 45
downstream ENSMUSE00000626511 ChrY:511171..511297 No primer for this exon
downstream ENSMUSE00000441428 ChrY:510235..510271 No primer for this exon
downstream ENSMUSE00000626510 ChrY:507347..507445 AAAGGCATCCTGAACCTTCC ChrY:507387..507406 60.44 50
downstream ENSMUSE00000626509 ChrY:506408..506627 CTTGCAAGGCATCCATAGGT ChrY:506562..506581 60.1 50
downstream ENSMUSE00000626508 ChrY:505566..505700 GGTAAGCTCTGCGGGTATTG ChrY:505577..505596 59.73 55
downstream ENSMUSE00000626507 ChrY:504533..504628 CTGTGCTGTGAAGCACTGTGT ChrY:504520..504540 60.15 52.38
downstream ENSMUSE00000626506 ChrY:494350..495077 TGCTTGGAGATATCGTGTGG ChrY:494996..495015 59.67 50
downstream ENSMUSE00000626505 ChrY:490598..490727 TGGGTGGATTCAACTTCTCC ChrY:490590..490609 59.9 50
downstream ENSMUSE00000626504 ChrY:489212..489317 GCAAGACCGCGAATTACTGT ChrY:489207..489226 60.28 50
downstream ENSMUSE00000626503 ChrY:488391..488596 CAGAGGGATCCCAGTTTTCA ChrY:488467..488486 60.04 50
downstream ENSMUSE00000626502 ChrY:474250..474314 No primer for this exon
downstream ENSMUSE00000626501 ChrY:474101..474175 GGGTGCTTTCTGTCTCCTTC ChrY:474129..474148 58.87 55
downstream ENSMUSE00000626500 ChrY:473291..473439 GCAGGAAGCTTTGTCAGCTC ChrY:473379..473398 60.28 55
downstream ENSMUSE00000626499 ChrY:471315..471429 TTCACAATCACCTGGACCAA ChrY:471346..471365 59.94 45
downstream ENSMUSE00000626498 ChrY:467479..467666 CAGTGCCTGCATTTATCCAA ChrY:467520..467539 59.69 45
downstream ENSMUSE00000626497 ChrY:466313..466454 No primer for this exon
downstream ENSMUSE00000626496 ChrY:439208..439334 CCATGCCACAAAACCTCTTT ChrY:439229..439248 59.97 45
downstream ENSMUSE00000568719 ChrY:436025..436195 TTTCGTGCACAGTTCTGACA ChrY:436088..436107 59 45
downstream ENSMUSE00000704564 ChrY:433587..435016 TGCGTAAGTCTCCCAACACA ChrY:433592..433611 60.3 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTAATCGCCTTGCAGCACA ChrY:570084..570104 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAATCGTGACTGGGAAAACC ChrY:561086..561106 58.89 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GAAGGATTAATCGCCTTGCAG ChrY:561198..561219 61.06 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGGATCGTGACTGGGAAAAC ChrY:561197..561217 58.99 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000068457