Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10473
Trapped Gene
2410001C21Rik (ENSMUSG00000027502)
Vector Insertion
Chr 2: 172266240 - 172270146
Public Clones D052G01 (ggtc) D052G01 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000170124 (Chr2:172266090..172266239 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTTTCTGATTTCGGCTTTG Chr2:172266149..172266168 59.69 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000170124 (Chr2:172266090..172266239 +)
Downstram Exon
ENSMUSE00000170125 (Chr2:172270147..172270241 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTTTCTGATTTCGGCTTTG Chr2:172266149..172266168 59.69 45 CCAGTTCAGCGTCTTTGTCA Chr2:172270171..172270190 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000170124 Chr2:172266090..172266239 GGTTTCTGATTTCGGCTTTG Chr2:172266149..172266168 59.69 45

*** Putative Vector Insertion (Chr 2: 172266240 - 172270146) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000170125 Chr2:172270147..172270241 CCAGTTCAGCGTCTTTGTCA Chr2:172270171..172270190 60.03 50
downstream ENSMUSE00000170130 Chr2:172270827..172270920 GATGCTTCTGATGTGCGATG Chr2:172270920..172270939 60.39 50
downstream ENSMUSE00000170128 Chr2:172272122..172272261 GGTTGTCAGAAAGCCTGAGC Chr2:172272155..172272174 60 55
downstream ENSMUSE00000170133 Chr2:172272535..172272613 CGCGTTCAGAAAACACACAA Chr2:172272581..172272600 60.88 45
downstream ENSMUSE00000679121 Chr2:172278752..172278817 TGAGGGCACATCACACACAT Chr2:172278774..172278793 61.05 50
downstream ENSMUSE00000170132 Chr2:172288677..172288790 CAGCATCTCCACATCCTCCT Chr2:172288748..172288767 60.22 55
downstream ENSMUSE00000170126 Chr2:172291774..172291831 GTCGCTGTCTTCGGTTTCTT Chr2:172291802..172291821 59.48 50
downstream ENSMUSE00000170134 Chr2:172291929..172292024 CAGGCTTGCCAGACTTCACT Chr2:172291970..172291989 60.59 55
downstream ENSMUSE00000170123 Chr2:172294096..172294367 CCAGACGCACTCCCATTAGT Chr2:172294120..172294139 60.13 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGTCGAGAAGGTCAGTGG Chr2:172266229..172266249 59.3 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGTCGAGAAGGTCAGTGG Chr2:172266229..172266249 59.3 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027502