Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10477
Trapped Gene
AC162389.6 (ENSMUSG00000079224)
Vector Insertion
Chr 6: 100554841 - 100554966
Public Clones D052D12 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000687829 (Chr6:100554670..100554840 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGATTATTGGGCCACCAAG Chr6:100554821..100554840 59.65 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000687829 (Chr6:100554670..100554840 +)
Downstram Exon
ENSMUSE00000687827 (Chr6:100554967..100555835 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGATTATTGGGCCACCAAG Chr6:100554821..100554840 59.65 45 ATTGTGCTGCACGTCTCTTG Chr6:100555316..100555335 60.06 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000687829 Chr6:100554670..100554840 ATGATTATTGGGCCACCAAG Chr6:100554821..100554840 59.65 45

*** Putative Vector Insertion (Chr 6: 100554841 - 100554966) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000687827 Chr6:100554967..100555835 ATTGTGCTGCACGTCTCTTG Chr6:100555316..100555335 60.06 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACAAGGTGGACAGGCATGAT Chr6:100554807..100554827 60.4 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAAGGTGGACAGGCATGAT Chr6:100554807..100554827 60.4 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079224