Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10480
Trapped Gene
Ppcdc (ENSMUSG00000063849)
Vector Insertion
Chr 9: 57269029 - 57282709
Public Clones (sanger) D121H09 (ggtc) D098D12 (ggtc) D121G09 (ggtc) E052B05 (ggtc)
D098D12 (ggtc) D050H09 (ggtc) FHCRC-GT-S10-11H1 (fhcrc) IST12920D1 (tigm)
IST11154G3 (tigm) IST14131E9 (tigm) IST12237H4 (tigm) IST12237H4 (tigm)
IST14593C5 (tigm)
Private Clones OST298464 (lexicon)
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000472416 (Chr9:57282710..57282892 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCTCACATGGAACCAAAGG Chr9:57282832..57282851 59.82 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000472416 (Chr9:57282710..57282892 -)
Downstram Exon
ENSMUSE00000421873 (Chr9:57268933..57269028 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCTCACATGGAACCAAAGG Chr9:57282832..57282851 59.82 50 CCATTCATCAGCGTCACTGT Chr9:57268914..57268933 59.71 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000474456 Chr9:57287877..57287921 TACTTGCGGGTATCCTGGAG Chr9:57287880..57287899 60.09 55
upstream ENSMUSE00000473445 Chr9:57285224..57285289 GGGGTCAAGGTTTGAGGACT Chr9:57285229..57285248 60.35 55
upstream ENSMUSE00000472416 Chr9:57282710..57282892 ACCTCACATGGAACCAAAGG Chr9:57282832..57282851 59.82 50

*** Putative Vector Insertion (Chr 9: 57269029 - 57282709) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000421873 Chr9:57268933..57269028 CCATTCATCAGCGTCACTGT Chr9:57268914..57268933 59.71 50
downstream ENSMUSE00000421597 Chr9:57267970..57268098 GGAGCCACTAGCATGAGGTC Chr9:57268003..57268022 59.83 60
downstream ENSMUSE00000469843 Chr9:57262893..57263061 GGAATCTCCACGTAGCCAAA Chr9:57262906..57262925 60.07 50
downstream ENSMUSE00000534256 Chr9:57260475..57262533 TTACCTGGTCAACCGTAGCC Chr9:57260522..57260541 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGCTTCTGGCACTAAGGA Chr9:57270662..57270682 60.4 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGGCTTCTGGCACTAAGGA Chr9:57270662..57270682 60.4 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGGCGAGAGACTCCCCTAAT Chr9:57279838..57279858 59.3 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGGAACGTTATCACATGCAG Chr9:57279856..57279876 59 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063849