Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10483
Trapped Gene
Mapk6 (ENSMUSG00000042688)
Vector Insertion
Chr 9: 75246559 - 75257669
Public Clones (sanger) D050E09 (ggtc) 3SE057D03 (ggtc) A006F10 (ggtc) D134E06 (ggtc)
P028B01 (ggtc) (ggtc) M124A11 (ggtc) M124A11 (ggtc) (ggtc)
D134E06 (ggtc) IST14406F2 (tigm)
Private Clones OST456526 (lexicon) OST455101 (lexicon) OST402774 (lexicon) OST391635 (lexicon)
OST388651 (lexicon) OST378316 (lexicon) OST338097 (lexicon) OST330154 (lexicon)
OST324415 (lexicon) OST324313 (lexicon) OST310492 (lexicon) OST222933 (lexicon)
OST199136 (lexicon) OST176461 (lexicon) OST148040 (lexicon) OST139198 (lexicon)
OST132443 (lexicon) OST112336 (lexicon) OST108254 (lexicon) OST103225 (lexicon)
OST90956 (lexicon) OST81234 (lexicon) OST68120 (lexicon) OST66661 (lexicon)
OST61755 (lexicon) OST58716 (lexicon) OST58597 (lexicon) OST58260 (lexicon)
OST58246 (lexicon) OST54006 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000421102 (Chr9:75257670..75257805 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCGATGAGTCGGAGAAGTCC Chr9:75257671..75257690 60.35 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000421102 (Chr9:75257670..75257805 -)
Downstram Exon
ENSMUSE00000474877 (Chr9:75245386..75246558 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCGATGAGTCGGAGAAGTCC Chr9:75257671..75257690 60.35 55 AGAGAGCCCACATCGTCTGT Chr9:75245626..75245645 59.87 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000421102 Chr9:75257670..75257805 TCGATGAGTCGGAGAAGTCC Chr9:75257671..75257690 60.35 55

*** Putative Vector Insertion (Chr 9: 75246559 - 75257669) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000474877 Chr9:75245386..75246558 AGAGAGCCCACATCGTCTGT Chr9:75245626..75245645 59.87 55
downstream ENSMUSE00000276231 Chr9:75243317..75243461 GCCGTGGAGATCTGTACCAT Chr9:75243391..75243410 59.96 55
downstream ENSMUSE00000276207 Chr9:75241172..75241336 GGAATCACGCTGAGAAGCTC Chr9:75241224..75241243 60.1 55
downstream ENSMUSE00000276174 Chr9:75237974..75238175 ATGTCGTCCACTTCGTCCTC Chr9:75237997..75238016 60.12 55
downstream ENSMUSE00000473100 Chr9:75234712..75236954 CATGCTCCGAGAACTGACAA Chr9:75236904..75236923 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGTCCTTCAGTGGAGTCAG Chr9:75254627..75254647 59.68 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGTCCTTCAGTGGAGTCAG Chr9:75254627..75254647 59.68 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CAAACCGAAGTGATGGTAGGT Chr9:75254812..75254833 58.97 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAAACCGAAGTGATGGTAGGT Chr9:75254812..75254833 58.97 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042688