Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10494
Trapped Gene
Lmna (ENSMUSG00000028063)
Vector Insertion
Chr 3: 88297235 - 88306669
Public Clones D020A09 (ggtc) M073F03 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000721382 (Chr3:88306670..88307229 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAAGTGCGTGAGGAGTTCA Chr3:88306686..88306705 60.03 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000721382 (Chr3:88306670..88307229 -)
Downstram Exon
ENSMUSE00000673454 (Chr3:88297159..88297234 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAAGTGCGTGAGGAGTTCA Chr3:88306686..88306705 60.03 50 CCTCAGGAGTTCCGGAAAGA Chr3:88297187..88297206 61.66 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000464930 Chr3:88306670..88307229 CAAAGTGCGTGAGGAGTTCA Chr3:88306686..88306705 60.03 50
upstream ENSMUSE00000721382 Chr3:88306670..88307229 CAAAGTGCGTGAGGAGTTCA Chr3:88306686..88306705 60.03 50

*** Putative Vector Insertion (Chr 3: 88297235 - 88306669) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000673454 Chr3:88297159..88297234 CCTCAGGAGTTCCGGAAAGA Chr3:88297187..88297206 61.66 55
downstream ENSMUSE00000419377 Chr3:88292197..88292353 CAACAAGTCCCCCTCCTTCT Chr3:88292304..88292323 60.48 55
downstream ENSMUSE00000175618 Chr3:88290730..88290855 CTCCTTCAGCGTCTGTAGCC Chr3:88290741..88290760 60.16 60
downstream ENSMUSE00000175619 Chr3:88290382..88290552 CTTCCCGTTATCGATCTCCA Chr3:88290471..88290490 60.03 50
downstream ENSMUSE00000175620 Chr3:88290126..88290251 GTCAATGCGGATTCGAGACT Chr3:88290140..88290159 60.23 50
downstream ENSMUSE00000175616 Chr3:88288849..88289069 AGCAGCTCCTGGTACTCGTC Chr3:88288896..88288915 59.63 60
downstream ENSMUSE00000175611 Chr3:88288537..88288759 GACTTCCTCTACCGCCACAC Chr3:88288560..88288579 59.73 60
downstream ENSMUSE00000175613 Chr3:88287969..88288076 GGGAAGCGATAGGTCATCAA Chr3:88287984..88288003 60.04 50
downstream ENSMUSE00000175612 Chr3:88287749..88287868 GCCTTCCACACCAAGTCAGT Chr3:88287788..88287807 60.16 55
downstream ENSMUSE00000175621 Chr3:88287240..88287335 TCTTCTCCATCCTCGTCGTC Chr3:88287237..88287256 60.35 55
downstream ENSMUSE00000419350 Chr3:88287128..88287335 TCTTCTCCATCCTCGTCGTC Chr3:88287237..88287256 60.35 55
downstream ENSMUSE00000708285 Chr3:88287127..88287335 TCTTCTCCATCCTCGTCGTC Chr3:88287237..88287256 60.35 55
downstream ENSMUSE00000500596 Chr3:88286268..88286534 TGACTAGGTTGTCCCCGAAG Chr3:88286287..88286306 60.1 55
downstream ENSMUSE00000673455 Chr3:88285996..88286022 ACATGATGCTGCAGTTCTGG Chr3:88285976..88285995 59.86 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCAGGCCAGCTCTAACATA Chr3:88303651..88303671 60.23 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCAGGCCAGCTCTAACATA Chr3:88303651..88303671 60.23 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028063