Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10501
Trapped Gene
Spin1 (ENSMUSG00000021395)
Vector Insertion
Chr 13: 51196360 - 51218456
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) E123H02 (ggtc) D058E12 (ggtc) (ggtc) H004C03 (ggtc)
E123A04 (ggtc) D005F09 (ggtc) P101C08 (ggtc) E022F08 (ggtc) 5SH004C03 (ggtc)
E123A05 (ggtc) D035E11 (ggtc) (ggtc) P024C11 (ggtc) E089G03 (ggtc)
D005F09 (ggtc) E123H02 (ggtc) D100E02 (ggtc) (ggtc) E123A05 (ggtc)
D035E11 (ggtc) P101C08 (ggtc) E085G03 (ggtc) D001G04 (ggtc) IST14820G12 (tigm)
IST14786H1 (tigm) IST13549A7 (tigm) IST15108A4 (tigm) IST14178H11 (tigm)
IST15001D1 (tigm) IST14594D8 (tigm) IST10907G12 (tigm)
Private Clones OST459706 (lexicon) OST446568 (lexicon) OST422466 (lexicon) OST401648 (lexicon)
OST392787 (lexicon) OST368270 (lexicon) OST330311 (lexicon) OST319514 (lexicon)
OST271017 (lexicon) OST251562 (lexicon) OST250225 (lexicon) OST249797 (lexicon)
OST234663 (lexicon) OST232668 (lexicon) OST232367 (lexicon) OST230777 (lexicon)
OST230091 (lexicon) OST223208 (lexicon) OST220612 (lexicon) OST220011 (lexicon)
OST212266 (lexicon) OST211821 (lexicon) OST203940 (lexicon) OST200248 (lexicon)
OST194786 (lexicon) OST178387 (lexicon) OST172949 (lexicon) OST156309 (lexicon)
OST150923 (lexicon) OST141976 (lexicon) OST111676 (lexicon) OST75401 (lexicon)
OST68337 (lexicon) OST68086 (lexicon) OST53841 (lexicon) OST41631 (lexicon)
OST32113 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000615586 (Chr13:51196249..51196359 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000615586 (Chr13:51196249..51196359 +)
Downstram Exon
ENSMUSE00000615585 (Chr13:51218457..51218657 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000615586 Chr13:51196249..51196359 No primer for this exon

*** Putative Vector Insertion (Chr 13: 51196360 - 51218456) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000615585 Chr13:51218457..51218657 No primer for this exon
downstream ENSMUSE00000615584 Chr13:51223294..51223342 No primer for this exon
downstream ENSMUSE00000682533 Chr13:51229692..51229751 No primer for this exon
downstream ENSMUSE00000615582 Chr13:51229717..51229751 No primer for this exon
downstream ENSMUSE00000351341 Chr13:51234726..51234979 No primer for this exon
downstream ENSMUSE00000682531 Chr13:51234726..51234749 No primer for this exon
downstream ENSMUSE00000411462 Chr13:51234751..51234979 No primer for this exon
downstream ENSMUSE00000240748 Chr13:51239671..51239904 No primer for this exon
downstream ENSMUSE00000682528 Chr13:51239671..51239877 No primer for this exon
downstream ENSMUSE00000682526 Chr13:51239977..51239980 No primer for this exon
downstream ENSMUSE00000475082 Chr13:51244331..51247915 No primer for this exon
downstream ENSMUSE00000642043 Chr13:51244331..51244530 No primer for this exon
downstream ENSMUSE00000682524 Chr13:51245988..51246135 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATCCTCCTGTGGAGTCAGG Chr13:51202332..51202352 60.67 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTGGAGACACAACGTGAC Chr13:51202397..51202417 59.71 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021395