Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10517
Trapped Gene
Fryl (ENSMUSG00000070733)
Vector Insertion
Chr 5: 73586353 - 73612146
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) 3SD181H01 (ggtc) (ggtc)
5SD101B02 (ggtc) (ggtc) (ggtc) 5SD122B04 (ggtc) (ggtc)
(ggtc) (ggtc) 3SD122B04 (ggtc) (ggtc) M098D04 (ggtc) (ggtc)
(ggtc) (egtc) IST12282C6 (tigm) IST14755A7 (tigm) IST14912E9 (tigm)
IST12457H6 (tigm) IST15000C2 (tigm) IST14112H11 (tigm) IST12589F6 (tigm)
IST14278E10 (tigm) IST14945G6 (tigm) IST14667F10 (tigm) IST10513F12 (tigm)
IST14432C10 (tigm) IST14631B11 (tigm) IST10843G9 (tigm) IST11527A11 (tigm)
IST14593G2 (tigm) IST10440A9 (tigm) IST11621C6 (tigm)
Private Clones OST455011 (lexicon) OST355641 (lexicon) OST351853 (lexicon) OST307617 (lexicon)
OST278585 (lexicon) OST276004 (lexicon) OST254307 (lexicon) OST246513 (lexicon)
OST223189 (lexicon) OST200301 (lexicon) OST167248 (lexicon) OST166621 (lexicon)
OST145565 (lexicon) OST131716 (lexicon) OST114052 (lexicon) OST62572 (lexicon)
OST45690 (lexicon) OST43414 (lexicon) OST34434 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000652772 (Chr5:73612147..73612311 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGCTCCAGGTTGAAGAAGC Chr5:73612218..73612237 60.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000652772 (Chr5:73612147..73612311 -)
Downstram Exon
ENSMUSE00000696294 (Chr5:73586225..73586352 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGCTCCAGGTTGAAGAAGC Chr5:73612218..73612237 60.13 55 CACTCCCGGCTAAGTTCTTG Chr5:73586211..73586230 59.87 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000652773 Chr5:73647639..73647857 TCCCGATCGGATTATTCCTT Chr5:73647740..73647759 60.6 45
upstream ENSMUSE00000652772 Chr5:73612147..73612311 CTGCTCCAGGTTGAAGAAGC Chr5:73612218..73612237 60.13 55

*** Putative Vector Insertion (Chr 5: 73586353 - 73612146) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000696294 Chr5:73586225..73586352 CACTCCCGGCTAAGTTCTTG Chr5:73586211..73586230 59.87 55
downstream ENSMUSE00000462436 Chr5:73559450..73559678 AGCAGCAATTCTGTGGCTCT Chr5:73559567..73559586 60.16 50
downstream ENSMUSE00000341324 Chr5:73539256..73539461 ACATATTCACCGGGCTTGAC Chr5:73539307..73539326 59.82 50
downstream ENSMUSE00000709128 Chr5:73539256..73539461 ACATATTCACCGGGCTTGAC Chr5:73539307..73539326 59.82 50
downstream ENSMUSE00000716364 Chr5:73539256..73539461 ACATATTCACCGGGCTTGAC Chr5:73539307..73539326 59.82 50
downstream ENSMUSE00000228813 Chr5:73527561..73527614 ACCCCTCTGAAGAGATCTGGA Chr5:73527560..73527580 60.2 52.38
downstream ENSMUSE00000696234 Chr5:73527561..73527614 ACCCCTCTGAAGAGATCTGGA Chr5:73527560..73527580 60.2 52.38
downstream ENSMUSE00000228809 Chr5:73524485..73524624 TAGGATTCATCGTCGGTTCC Chr5:73524499..73524518 59.89 50
downstream ENSMUSE00000696233 Chr5:73524485..73524624 TAGGATTCATCGTCGGTTCC Chr5:73524499..73524518 59.89 50
downstream ENSMUSE00000228801 Chr5:73523710..73523806 GTAATCTCTCTCGCGGTGCT Chr5:73523757..73523776 59.6 55
downstream ENSMUSE00000696232 Chr5:73523710..73523806 GTAATCTCTCTCGCGGTGCT Chr5:73523757..73523776 59.6 55
downstream ENSMUSE00000598421 Chr5:73516754..73516833 GGCACAGGATGAACAGGAAT Chr5:73516792..73516811 59.93 50
downstream ENSMUSE00000696231 Chr5:73516754..73516833 GGCACAGGATGAACAGGAAT Chr5:73516792..73516811 59.93 50
downstream ENSMUSE00000228785 Chr5:73515922..73516002 AAATCCGCAATGATATGCAC Chr5:73515936..73515955 58.46 40
downstream ENSMUSE00000696229 Chr5:73515922..73516002 AAATCCGCAATGATATGCAC Chr5:73515936..73515955 58.46 40
downstream ENSMUSE00000598420 Chr5:73513452..73513620 TGCATGAACTGAAAGGATGC Chr5:73513431..73513450 59.81 45
downstream ENSMUSE00000696227 Chr5:73513452..73513620 TGCATGAACTGAAAGGATGC Chr5:73513431..73513450 59.81 45
downstream ENSMUSE00000443187 Chr5:73513103..73513195 ACGGGGATAAGGATCTCCAC Chr5:73513088..73513107 60.15 55
downstream ENSMUSE00000696226 Chr5:73513103..73513195 ACGGGGATAAGGATCTCCAC Chr5:73513088..73513107 60.15 55
downstream ENSMUSE00000598419 Chr5:73511057..73511155 CAGCGAATGCTTCTTTCTGG Chr5:73511035..73511054 61.04 50
downstream ENSMUSE00000696225 Chr5:73511057..73511155 CAGCGAATGCTTCTTTCTGG Chr5:73511035..73511054 61.04 50
downstream ENSMUSE00000598418 Chr5:73509723..73509824 No primer for this exon
downstream ENSMUSE00000696224 Chr5:73509723..73509824 No primer for this exon
downstream ENSMUSE00000513074 Chr5:73503988..73504091 CTCCAGTGCAACTCGAGACA Chr5:73504034..73504053 60.18 55
downstream ENSMUSE00000696223 Chr5:73503988..73504091 CTCCAGTGCAACTCGAGACA Chr5:73504034..73504053 60.18 55
downstream ENSMUSE00000510113 Chr5:73503602..73503710 CCTTTGGGAAAAGAGCAGAC Chr5:73503651..73503670 58.91 50
downstream ENSMUSE00000696222 Chr5:73503602..73503710 CCTTTGGGAAAAGAGCAGAC Chr5:73503651..73503670 58.91 50
downstream ENSMUSE00000507429 Chr5:73501425..73501511 TTCATTGCAAAATCCAAACG Chr5:73501467..73501486 59.54 35
downstream ENSMUSE00000696221 Chr5:73501425..73501511 TTCATTGCAAAATCCAAACG Chr5:73501467..73501486 59.54 35
downstream ENSMUSE00000598417 Chr5:73499709..73499880 TGACTTTGGCCTCTTCGTCT Chr5:73499690..73499709 59.99 50
downstream ENSMUSE00000696220 Chr5:73499709..73499880 TGACTTTGGCCTCTTCGTCT Chr5:73499690..73499709 59.99 50
downstream ENSMUSE00000509449 Chr5:73499202..73499334 CACATTGGTCTCCCAACCTC Chr5:73499228..73499247 60.36 55
downstream ENSMUSE00000696219 Chr5:73499202..73499334 CACATTGGTCTCCCAACCTC Chr5:73499228..73499247 60.36 55
downstream ENSMUSE00000652775 Chr5:73495914..73496021 CATACCATCGGGAATCAACC Chr5:73495924..73495943 60.01 50
downstream ENSMUSE00000696218 Chr5:73495914..73496021 CATACCATCGGGAATCAACC Chr5:73495924..73495943 60.01 50
downstream ENSMUSE00000506459 Chr5:73492693..73492930 GGGGTGGACATCAGTCACTT Chr5:73492764..73492783 59.82 55
downstream ENSMUSE00000696217 Chr5:73492693..73492930 GGGGTGGACATCAGTCACTT Chr5:73492764..73492783 59.82 55
downstream ENSMUSE00000519126 Chr5:73491525..73491710 TCTCTCGAAGGACGCTGACT Chr5:73491538..73491557 60.28 55
downstream ENSMUSE00000696216 Chr5:73491525..73491710 TCTCTCGAAGGACGCTGACT Chr5:73491538..73491557 60.28 55
downstream ENSMUSE00000696215 Chr5:73491185..73491271 CGTGAGGTGGATGAAGCTCT Chr5:73491175..73491194 60.41 55
downstream ENSMUSE00000696278 Chr5:73491185..73491271 CGTGAGGTGGATGAAGCTCT Chr5:73491175..73491194 60.41 55
downstream ENSMUSE00000508530 Chr5:73490753..73491271 CAGACGTGGGTGTGTATTCG Chr5:73491096..73491115 60.03 55
downstream ENSMUSE00000696214 Chr5:73489398..73489666 AGGGGCTGATCACATCAAAC Chr5:73489548..73489567 59.93 50
downstream ENSMUSE00000696277 Chr5:73489398..73489666 AGGGGCTGATCACATCAAAC Chr5:73489548..73489567 59.93 50
downstream ENSMUSE00000696213 Chr5:73488613..73488808 GCTCGTGGTGGCATTTACTT Chr5:73488747..73488766 60.14 50
downstream ENSMUSE00000696276 Chr5:73488613..73488808 GCTCGTGGTGGCATTTACTT Chr5:73488747..73488766 60.14 50
downstream ENSMUSE00000696212 Chr5:73487513..73487637 AGGCCTAGAACGAGGGACTC Chr5:73487518..73487537 59.84 60
downstream ENSMUSE00000696275 Chr5:73487513..73487637 AGGCCTAGAACGAGGGACTC Chr5:73487518..73487537 59.84 60
downstream ENSMUSE00000696211 Chr5:73486655..73486712 TCTGGCCTTCTTTCAAGTGC Chr5:73486634..73486653 60.52 50
downstream ENSMUSE00000696274 Chr5:73486655..73486712 TCTGGCCTTCTTTCAAGTGC Chr5:73486634..73486653 60.52 50
downstream ENSMUSE00000696210 Chr5:73484362..73484453 TGGCTAATGACACCAGCATC Chr5:73484343..73484362 59.68 50
downstream ENSMUSE00000696273 Chr5:73484362..73484453 TGGCTAATGACACCAGCATC Chr5:73484343..73484362 59.68 50
downstream ENSMUSE00000696209 Chr5:73481840..73482012 TGTCGGAGTCCTTCTCGTTT Chr5:73481881..73481900 59.84 50
downstream ENSMUSE00000696272 Chr5:73481840..73482012 TGTCGGAGTCCTTCTCGTTT Chr5:73481881..73481900 59.84 50
downstream ENSMUSE00000696208 Chr5:73480334..73480494 GGCGTGAACATGATGCTAAA Chr5:73480373..73480392 59.69 45
downstream ENSMUSE00000696271 Chr5:73480334..73480494 GGCGTGAACATGATGCTAAA Chr5:73480373..73480392 59.69 45
downstream ENSMUSE00000696207 Chr5:73479608..73479718 CAGGGCCACAACACAGTACA Chr5:73479666..73479685 60.63 55
downstream ENSMUSE00000696269 Chr5:73479608..73479718 CAGGGCCACAACACAGTACA Chr5:73479666..73479685 60.63 55
downstream ENSMUSE00000696206 Chr5:73478117..73478271 AGCAACGTGACTGCTTCACA Chr5:73478215..73478234 60.66 50
downstream ENSMUSE00000696268 Chr5:73478117..73478271 AGCAACGTGACTGCTTCACA Chr5:73478215..73478234 60.66 50
downstream ENSMUSE00000696205 Chr5:73477766..73477865 No primer for this exon
downstream ENSMUSE00000696267 Chr5:73477766..73477865 No primer for this exon
downstream ENSMUSE00000696204 Chr5:73476586..73476754 CTCCATCCGTTCTCTGAACC Chr5:73476672..73476691 59.65 55
downstream ENSMUSE00000696265 Chr5:73476586..73476754 CTCCATCCGTTCTCTGAACC Chr5:73476672..73476691 59.65 55
downstream ENSMUSE00000696203 Chr5:73474367..73474626 CCATGAGCTCTCGGTCTTTC Chr5:73474437..73474456 59.95 55
downstream ENSMUSE00000696264 Chr5:73474367..73474626 CCATGAGCTCTCGGTCTTTC Chr5:73474437..73474456 59.95 55
downstream ENSMUSE00000696202 Chr5:73474036..73474176 GAGGCTTGGTTCGCTATTCA Chr5:73474023..73474042 60.35 50
downstream ENSMUSE00000696263 Chr5:73474036..73474176 GAGGCTTGGTTCGCTATTCA Chr5:73474023..73474042 60.35 50
downstream ENSMUSE00000696201 Chr5:73472203..73472371 GAGGTGACGGAAGGGATTTT Chr5:73472183..73472202 60.31 50
downstream ENSMUSE00000696262 Chr5:73472203..73472371 GAGGTGACGGAAGGGATTTT Chr5:73472183..73472202 60.31 50
downstream ENSMUSE00000696200 Chr5:73467897..73467981 GGAGCGACCATTGTATTGCT Chr5:73467926..73467945 60.1 50
downstream ENSMUSE00000696261 Chr5:73467897..73467981 GGAGCGACCATTGTATTGCT Chr5:73467926..73467945 60.1 50
downstream ENSMUSE00000598462 Chr5:73467127..73467239 TTCAGTCCCCCGTAGATGTC Chr5:73467185..73467204 59.93 55
downstream ENSMUSE00000696260 Chr5:73467127..73467239 TTCAGTCCCCCGTAGATGTC Chr5:73467185..73467204 59.93 55
downstream ENSMUSE00000598461 Chr5:73465868..73466018 GATGCTGTTTCAGGCACGTA Chr5:73465867..73465886 59.87 50
downstream ENSMUSE00000696259 Chr5:73465868..73466018 GATGCTGTTTCAGGCACGTA Chr5:73465867..73465886 59.87 50
downstream ENSMUSE00000598460 Chr5:73465081..73465184 TTCACGCTGTGGTCAATGAT Chr5:73465109..73465128 60.12 45
downstream ENSMUSE00000696258 Chr5:73465081..73465184 TTCACGCTGTGGTCAATGAT Chr5:73465109..73465128 60.12 45
downstream ENSMUSE00000598459 Chr5:73463975..73464160 TTGCAGTGCTCGTACACCTC Chr5:73464099..73464118 60.06 55
downstream ENSMUSE00000696257 Chr5:73463975..73464160 TTGCAGTGCTCGTACACCTC Chr5:73464099..73464118 60.06 55
downstream ENSMUSE00000598458 Chr5:73462344..73462548 ATAGGGGACGGCTGGTAATC Chr5:73462484..73462503 60.17 55
downstream ENSMUSE00000696256 Chr5:73462344..73462548 ATAGGGGACGGCTGGTAATC Chr5:73462484..73462503 60.17 55
downstream ENSMUSE00000598457 Chr5:73461122..73461243 AAACGTCCTCATGGTTCCAA Chr5:73461187..73461206 60.35 45
downstream ENSMUSE00000598456 Chr5:73459963..73460153 GGAGAGGACATCGGAGAGTG Chr5:73459983..73460002 59.79 60
downstream ENSMUSE00000598455 Chr5:73458513..73458607 TTCATGGTTTCAGCCAAGGT Chr5:73458521..73458540 60.49 45
downstream ENSMUSE00000598454 Chr5:73456178..73456785 CCGGGGAAGTTACTCCATTT Chr5:73456278..73456297 60.18 50
downstream ENSMUSE00000598453 Chr5:73455745..73455842 AGTTGGGCTGTCAAAATGCT Chr5:73455759..73455778 59.74 45
downstream ENSMUSE00000598452 Chr5:73450618..73450788 CAAGACTGAAGGTCGCCTCT Chr5:73450613..73450632 59.6 55
downstream ENSMUSE00000598451 Chr5:73448963..73449103 TGTAGCAACGACTGCTGCAT Chr5:73449038..73449057 60.63 50
downstream ENSMUSE00000598450 Chr5:73446764..73446961 GAGCCTACGTCCACTCCGTA Chr5:73446830..73446849 60.28 60
downstream ENSMUSE00000598449 Chr5:73445955..73446116 GAACTAGGGCGTTGGATGTG Chr5:73445965..73445984 60.52 55
downstream ENSMUSE00000598448 Chr5:73445769..73445843 GCACGCTCATCAGCTTCTCT Chr5:73445791..73445810 60.85 55
downstream ENSMUSE00000598447 Chr5:73445292..73445468 TTCGACGGCAACTTCTTCTT Chr5:73445345..73445364 59.99 45
downstream ENSMUSE00000598446 Chr5:73441541..73441744 TATCCTCCTGGTTCGTCAGG Chr5:73441584..73441603 60.06 55
downstream ENSMUSE00000598445 Chr5:73438759..73438923 GGGTCTCGTCTCTGATCTGC Chr5:73438784..73438803 59.95 60
downstream ENSMUSE00000598444 Chr5:73432585..73432832 AGATGGACTCGGGGTAGCTT Chr5:73432645..73432664 60.1 55
downstream ENSMUSE00000598443 Chr5:73426185..73426392 CGACAGCGTCTGATTGACAT Chr5:73426220..73426239 59.86 50
downstream ENSMUSE00000598442 Chr5:73424835..73424984 TGGTACCAATGCGCTGTAGA Chr5:73424884..73424903 60.28 50
downstream ENSMUSE00000598441 Chr5:73423997..73424095 CAAGACGCCAAACTTGAGTG Chr5:73424029..73424048 59.49 50
downstream ENSMUSE00000598440 Chr5:73418555..73418623 ACCGAATGTCCTCTTGCAGT Chr5:73418572..73418591 59.73 50
downstream ENSMUSE00000598439 Chr5:73415127..73415237 GTTTGCAGTAGGCCTGGAAC Chr5:73415143..73415162 59.74 55
downstream ENSMUSE00000598438 Chr5:73413741..73413931 GCCGCTTTGGAGATATCAAT Chr5:73413812..73413831 59.14 45
downstream ENSMUSE00000598437 Chr5:73411430..73413536 CGTTGGGAGGCTACATTCAT Chr5:73411859..73411878 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGAGAGACACACTGCTCCT Chr5:73594166..73594186 58.53 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAGAGACACACTGCTCCT Chr5:73594166..73594186 58.53 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GATTAATCGCCTTGCAGCAC Chr5:73594244..73594264 60.75 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGCCTGGGAGTGTGTTCTTA Chr5:73600335..73600355 60.11 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000070733