Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10523
Trapped Gene
Adam19 (ENSMUSG00000011256)
Vector Insertion
Chr 11: 45874853 - 45878513
Public Clones (sanger) G053F03 (ggtc) G066F01 (ggtc) G035C09 (ggtc) G046H05 (ggtc)
G042G05 (ggtc) P071G09 (ggtc) G076H07 (ggtc) (ggtc) G061D01 (ggtc)
G077A07 (ggtc) G053D09 (ggtc) G043H10 (ggtc) G065E12 (ggtc) G033F11 (ggtc)
G044D03 (ggtc) G033B10 (ggtc) G071B11 (ggtc) G054B01 (ggtc) G071C01 (ggtc)
G044F06 (ggtc) G059C10 (ggtc) G043B04 (ggtc) M090F01 (ggtc) G033D06 (ggtc)
P069B06 (ggtc) G031G03 (ggtc) G065H09 (ggtc) CMHD-GT_473G7-3 (cmhd) IST10516H4 (tigm)
IST10516H4 (tigm) IST10736D5 (tigm) IST12246D12 (tigm) IST10736D5 (tigm)
IST12246D12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000679625 (Chr11:45874425..45874852 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000679625 (Chr11:45874425..45874852 +)
Downstram Exon
ENSMUSE00000104348 (Chr11:45878514..45878584 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679628 Chr11:45869489..45869712 No primer for this exon
upstream ENSMUSE00000248605 Chr11:45869587..45869712 No primer for this exon
upstream ENSMUSE00000248599 Chr11:45874425..45874510 No primer for this exon
upstream ENSMUSE00000679625 Chr11:45874425..45874852 No primer for this exon

*** Putative Vector Insertion (Chr 11: 45874853 - 45878513) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000104348 Chr11:45878514..45878584 No primer for this exon
downstream ENSMUSE00000104363 Chr11:45907365..45907443 No primer for this exon
downstream ENSMUSE00000104327 Chr11:45913355..45913431 No primer for this exon
downstream ENSMUSE00000104368 Chr11:45926259..45926451 No primer for this exon
downstream ENSMUSE00000104331 Chr11:45927125..45927190 No primer for this exon
downstream ENSMUSE00000104330 Chr11:45931922..45931993 No primer for this exon
downstream ENSMUSE00000104343 Chr11:45934922..45935088 No primer for this exon
downstream ENSMUSE00000104360 Chr11:45936595..45936679 No primer for this exon
downstream ENSMUSE00000104370 Chr11:45938510..45938649 No primer for this exon
downstream ENSMUSE00000104358 Chr11:45940748..45940925 No primer for this exon
downstream ENSMUSE00000484177 Chr11:45942288..45942377 No primer for this exon
downstream ENSMUSE00000104369 Chr11:45945125..45945320 No primer for this exon
downstream ENSMUSE00000248522 Chr11:45947930..45948038 No primer for this exon
downstream ENSMUSE00000104340 Chr11:45949750..45949963 No primer for this exon
downstream ENSMUSE00000104329 Chr11:45950866..45950943 No primer for this exon
downstream ENSMUSE00000104345 Chr11:45951042..45951150 No primer for this exon
downstream ENSMUSE00000104356 Chr11:45952339..45952477 No primer for this exon
downstream ENSMUSE00000104351 Chr11:45953195..45953279 No primer for this exon
downstream ENSMUSE00000104347 Chr11:45953508..45953732 No primer for this exon
downstream ENSMUSE00000104350 Chr11:45956421..45956573 No primer for this exon
downstream ENSMUSE00000335467 Chr11:45957294..45960845 No primer for this exon
downstream ENSMUSE00000679624 Chr11:45958305..45959138 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGTGTATGGTGTGTTTGG Chr11:45877819..45877839 60.13 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGTGTATGGTGTGTTTGG Chr11:45877819..45877839 60.13 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000011256