Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10534
Trapped Gene
Cdh1 (ENSMUSG00000000303)
Vector Insertion
Chr 8: 109127443 - 109128186
Public Clones G056E12 (ggtc) G003D03 (ggtc) G056B01 (ggtc) G045D09 (ggtc) G055F11 (ggtc)
G038A07 (ggtc) G036G12 (ggtc) G030C06 (ggtc) G025H07 (ggtc) G082B05 (ggtc)
G070H03 (ggtc) G064H08 (ggtc) G051D12 (ggtc) G074G06 (ggtc) G064F08 (ggtc)
D051F04 (ggtc) G082C09 (ggtc) G064D09 (ggtc) G050G10 (ggtc) G047D02 (ggtc)
G064A12 (ggtc) G037G11 (ggtc) G036B02 (ggtc) G030B09 (ggtc) G024A07 (ggtc)
G079B09 (ggtc) G070A02 (ggtc) G014F05 (ggtc) G028C04 (ggtc) G070G04 (ggtc)
G057B06 (ggtc) G004B08 (ggtc) G057D06 (ggtc) G045B01 (ggtc) G050E09 (ggtc)
G038E11 (ggtc) G037A06 (ggtc) G030G11 (ggtc) G029B02 (ggtc) G082E08 (ggtc)
G074A08 (ggtc) G069A11 (ggtc) G003C05 (ggtc) G075D03 (ggtc) G003B04 (ggtc)
G045B07 (ggtc) G050F05 (ggtc) G023H06 (ggtc) G055H09 (ggtc) G045G10 (ggtc)
G057A03 (ggtc) G085B01 (ggtc) G036F08 (ggtc) G030C07 (ggtc) G025G06 (ggtc)
G079E04 (ggtc) G070C02 (ggtc) G020E12 (ggtc) G054G12 (ggtc) G074F04 (ggtc)
G064D08 (ggtc) G074E07 (ggtc) G063H11 (ggtc) G047C11 (ggtc) G050A06 (ggtc)
G038G12 (ggtc) G085A09 (ggtc) G039A03 (ggtc) G030B01 (ggtc) G023G02 (ggtc)
G079B02 (ggtc) G069F02 (ggtc) G003E05 (ggtc) G082B01 (ggtc) G069H03 (ggtc)
G056G12 (ggtc) G003F05 (ggtc) G056H04 (ggtc) G045C07 (ggtc) G055A10 (ggtc)
G085C08 (ggtc) G036G09 (ggtc) G030E07 (ggtc) G030F12 (ggtc) G082D09 (ggtc)
G071A01 (ggtc) G064G08 (ggtc) G047G02 (ggtc) G075C02 (ggtc) G085G01 (ggtc)
G082B03 (ggtc) G045F12 (ggtc) G003C03 (ggtc) G052A05 (ggtc) G047B08 (ggtc)
G057C05 (ggtc) G038B09 (ggtc) G036E11 (ggtc) G030B02 (ggtc) G025B03 (ggtc)
G079D07 (ggtc) G070C07 (ggtc) G016C03 (ggtc) G038H03 (ggtc) G072A04 (ggtc)
G057E06 (ggtc) G004E07 (ggtc) G057D01 (ggtc) G047D06 (ggtc) G050D04 (ggtc)
G038G04 (ggtc) G037C09 (ggtc) G032D04 (ggtc) G029G03 (ggtc) G082E05 (ggtc)
G074F08 (ggtc) G069A09 (ggtc) G003E01 (ggtc) G079F02 (ggtc) G004F06 (ggtc)
G023F06 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000334955 (Chr8:109127268..109127442 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000334955 (Chr8:109127268..109127442 +)
Downstram Exon
ENSMUSE00000214612 (Chr8:109128187..109128307 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000334955 Chr8:109127268..109127442 No primer for this exon

*** Putative Vector Insertion (Chr 8: 109127443 - 109128186) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214612 Chr8:109128187..109128307 No primer for this exon
downstream ENSMUSE00000214610 Chr8:109172901..109173124 No primer for this exon
downstream ENSMUSE00000214615 Chr8:109177407..109177550 No primer for this exon
downstream ENSMUSE00000214606 Chr8:109177664..109177819 No primer for this exon
downstream ENSMUSE00000214613 Chr8:109180724..109180868 No primer for this exon
downstream ENSMUSE00000214611 Chr8:109181640..109181815 No primer for this exon
downstream ENSMUSE00000214609 Chr8:109182091..109182219 No primer for this exon
downstream ENSMUSE00000214607 Chr8:109183490..109183672 No primer for this exon
downstream ENSMUSE00000214608 Chr8:109184696..109184940 No primer for this exon
downstream ENSMUSE00000330782 Chr8:109185785..109185930 No primer for this exon
downstream ENSMUSE00000330746 Chr8:109187647..109187871 No primer for this exon
downstream ENSMUSE00000330716 Chr8:109188096..109188323 No primer for this exon
downstream ENSMUSE00000330686 Chr8:109189294..109189424 No primer for this exon
downstream ENSMUSE00000330659 Chr8:109190087..109190230 No primer for this exon
downstream ENSMUSE00000469626 Chr8:109192306..109194146 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGTATGTGGAGGGTCCTG Chr8:109127441..109127461 60.38 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGTATGTGGAGGGTCCTG Chr8:109127441..109127461 60.38 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000303