Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10556
Trapped Gene
Tomm7 (ENSMUSG00000028998)
Vector Insertion
Chr 5: 23347577 - 23349788
Public Clones W212D06 (ggtc) G035B04 (ggtc) CMHD-GT_308B04-3 (cmhd) CMHD-GT_498C12-3 (cmhd)
CMHD-GT_154H9-3 (cmhd) CMHD-GT_458G8-3 (cmhd) PSTVUpb1H2 (vanderbilt)
Private Clones OST463138 (lexicon) OST463134 (lexicon) OST463118 (lexicon) OST463111 (lexicon)
OST463095 (lexicon) OST389572 (lexicon) OST330029 (lexicon) OST317307 (lexicon)
OST310408 (lexicon) OST200243 (lexicon) OST197357 (lexicon) OST171774 (lexicon)
OST124602 (lexicon) OST120419 (lexicon) OST120263 (lexicon) OST119925 (lexicon)
OST119882 (lexicon) OST115404 (lexicon) OST115220 (lexicon) OST69153 (lexicon)
OST60687 (lexicon) OST60167 (lexicon) OST30328 (lexicon) OST29808 (lexicon)
OST28193 (lexicon) OST28169 (lexicon) OST27767 (lexicon) OST27753 (lexicon)
OST26761 (lexicon) OST26343 (lexicon) OST24623 (lexicon) OST23732 (lexicon)
OST23012 (lexicon) OST19552 (lexicon) OST19120 (lexicon) OST19015 (lexicon)
OST17356 (lexicon) OST17034 (lexicon) OST16911 (lexicon) OST15363 (lexicon)
OST14973 (lexicon) OST14937 (lexicon) OST14067 (lexicon) OST12167 (lexicon)
OST9561 (lexicon) OST7040 (lexicon) OST6212 (lexicon) OST1226 (lexicon)
Severity of mutation (?) Insertion after 61% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000184331 (Chr5:23349789..23349925 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGGGGCTTTATTCCTCTC Chr5:23349802..23349821 60.17 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000184331 (Chr5:23349789..23349925 -)
Downstram Exon
ENSMUSE00000184329 (Chr5:23347528..23347576 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGGGGCTTTATTCCTCTC Chr5:23349802..23349821 60.17 55 AGGATCTGCACCCCTTGTAA Chr5:23347532..23347551 59.55 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000184331 Chr5:23349789..23349925 GCTGGGGCTTTATTCCTCTC Chr5:23349802..23349821 60.17 55

*** Putative Vector Insertion (Chr 5: 23347577 - 23349788) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000184329 Chr5:23347528..23347576 AGGATCTGCACCCCTTGTAA Chr5:23347532..23347551 59.55 50
downstream ENSMUSE00000602608 Chr5:23345472..23345646 CTCTGCCACAGAATCGTTGA Chr5:23345507..23345526 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGGGCTTTATTCCTCTCG Chr5:23349799..23349819 61.07 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGGGCTTTATTCCTCTCG Chr5:23349799..23349819 61.07 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028998