Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10562
Trapped Gene
Clpx (ENSMUSG00000015357)
Vector Insertion
Chr 9: 65172107 - 65174588
Public Clones G031C08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000219339 (Chr9:65172014..65172106 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000219339 (Chr9:65172014..65172106 +)
Downstram Exon
ENSMUSE00000219337 (Chr9:65174589..65174695 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000248308 Chr9:65142102..65142372 No primer for this exon
upstream ENSMUSE00000248286 Chr9:65147708..65147871 No primer for this exon
upstream ENSMUSE00000248269 Chr9:65149655..65149772 No primer for this exon
upstream ENSMUSE00000248250 Chr9:65156275..65156429 No primer for this exon
upstream ENSMUSE00000248231 Chr9:65157959..65158118 No primer for this exon
upstream ENSMUSE00000248215 Chr9:65159905..65159946 No primer for this exon
upstream ENSMUSE00000248197 Chr9:65164451..65164627 No primer for this exon
upstream ENSMUSE00000219336 Chr9:65165136..65165300 No primer for this exon
upstream ENSMUSE00000219333 Chr9:65166470..65166558 No primer for this exon
upstream ENSMUSE00000219335 Chr9:65168626..65168790 No primer for this exon
upstream ENSMUSE00000219338 Chr9:65170351..65170650 No primer for this exon
upstream ENSMUSE00000219339 Chr9:65172014..65172106 No primer for this exon

*** Putative Vector Insertion (Chr 9: 65172107 - 65174588) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000219337 Chr9:65174589..65174695 No primer for this exon
downstream ENSMUSE00000346977 Chr9:65177621..65178465 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:65172157..65172177 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCGGATTCTTAGTGACGTG Chr9:65172142..65172162 60.51 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015357