Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10567
Trapped Gene
Sema4b (ENSMUSG00000030539)
Vector Insertion
Chr 7: 87331878 - 87343404
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) P010G07 (ggtc)
E062G01 (ggtc) D144C05 (ggtc) 3SE223H02 (ggtc) (ggtc) E119H08 (ggtc)
D172H08 (ggtc) (ggtc) (ggtc) P068D09 (ggtc) E068A09 (ggtc) D156D10 (ggtc)
(ggtc) (ggtc) P136A07 (ggtc) E043G06 (ggtc) D144C05 (ggtc) 5SE386A04 (ggtc)
(ggtc) E087F02 (ggtc) D156D11 (ggtc) (ggtc) (ggtc) P056E10 (ggtc)
E068A09 (ggtc) D156D10 (ggtc) 5SE223H02 (ggtc) (ggtc) (ggtc)
E128H05 (ggtc) D188B06 (ggtc) D128H05 (ggtc) (ggtc) E087F02 (ggtc)
D156D11 (ggtc) (ggtc) (ggtc) (cmhd) IST12692A6 (tigm) IST14785D12 (tigm)
IST11823F12 (tigm) IST11706C7 (tigm) IST13057G10 (tigm) IST14536F7 (tigm)
IST12907F7 (tigm) IST15066F7 (tigm) IST11206E1 (tigm) IST13823H10 (tigm)
IST10534C6 (tigm) IST14540G8 (tigm) IST12046C2 (tigm) IST12522G7BBF1 (tigm)
IST10981D5 (tigm) IST13521H12 (tigm) IST13158F10 (tigm) IST12794C10 (tigm)
IST12362D6 (tigm) IST10323F12 (tigm) IST10330A8 (tigm) IST14214C5 (tigm)
IST11922G11 (tigm) IST12988G4 (tigm) IST14141E5 (tigm) IST12957G2 (tigm)
IST11603E5 (tigm) IST14561C7 (tigm) IST13573F10 (tigm) IST12146F6 (tigm)
IST13521H12 (tigm) IST14677D6 (tigm) IST11597E12 (tigm) IST10510C1 (tigm)
IST14936A2 (tigm) IST10534C6 (tigm) IST14780H8 (tigm) IST14480C6 (tigm)
IST11823F12 (tigm) IST12158F8 (tigm) IST10939F10 (tigm) IST14515G5 (tigm)
IST12142G11 (tigm) IST10983D9 (tigm) IST12877E2 (tigm) IST10491G6 (tigm)
IST13823H10 (tigm) IST12142G11 (tigm) IST12686E11 (tigm) IST14455G2 (tigm)
IST10797E12 (tigm) IST10943F4 (tigm) IST13194H6 (tigm) IST11029E12 (tigm)
IST11711D2BBF1 (tigm) IST10090H10 (tigm) IST13995A11 (tigm) IST12432G9 (tigm)
IST14413G8 (tigm) IST14047E4 (tigm) IST11006D10 (tigm) IST14483F12 (tigm)
IST10649B10 (tigm) IST11706C7 (tigm) IST15066F7 (tigm) IST14892D7 (tigm)
IST14480C6 (tigm) IST14965B10 (tigm) IST14464E4 (tigm) IST11314H7 (tigm)
IST12794D8 (tigm) IST14073H6 (tigm) IST12296B4 (tigm) IST13194H6 (tigm)
IST10327E7 (tigm) IST10485D2 (tigm) IST13160F10 (tigm) IST11263C5 (tigm)
IST12003B6 (tigm) IST12772F3 (tigm) IST10649B10 (tigm) IST14668G4 (tigm)
IST12432G9 (tigm) IST11922G11 (tigm) IST10752E1 (tigm) IST14073G6 (tigm)
IST14558H7 (tigm) IST10526C8 (tigm) IST10323F12 (tigm) IST14178A5 (tigm)
IST13119D7 (tigm) IST12362D6 (tigm) IST13119D7 (tigm) IST13390E6 (tigm)
IST12986F4 (tigm) IST14660H6 (tigm) IST14653E1 (tigm) IST14337D11 (tigm)
IST14445C1 (tigm) IST13573F1 (tigm) IST14530B1 (tigm) IST13107C10 (tigm)
IST14468D8 (tigm) IST11337A7 (tigm) IST10765D2 (tigm) IST13668F5 (tigm)
IST14073G6 (tigm) IST10985F5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000507158 (Chr7:87331727..87331877 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCACGGGATACTCCAGGTC Chr7:87331757..87331776 59.93 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000507158 (Chr7:87331727..87331877 +)
Downstram Exon
ENSMUSE00000475341 (Chr7:87343405..87343656 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCACGGGATACTCCAGGTC Chr7:87331757..87331776 59.93 55 CTCAGGTTGCTCAAGTGGAA Chr7:87343492..87343511 59.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000507158 Chr7:87331727..87331877 TTCACGGGATACTCCAGGTC Chr7:87331757..87331776 59.93 55

*** Putative Vector Insertion (Chr 7: 87331878 - 87343404) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000475341 Chr7:87343405..87343656 CTCAGGTTGCTCAAGTGGAA Chr7:87343492..87343511 59.01 50
downstream ENSMUSE00000718257 Chr7:87343405..87343656 CTCAGGTTGCTCAAGTGGAA Chr7:87343492..87343511 59.01 50
downstream ENSMUSE00000200269 Chr7:87357682..87357845 ATACAGCGTCTTGCCATCCT Chr7:87357776..87357795 59.72 50
downstream ENSMUSE00000200268 Chr7:87358149..87358211 TCCTGTCAGCATCTGCACTC Chr7:87358179..87358198 60.15 55
downstream ENSMUSE00000200275 Chr7:87360510..87360608 CTGTTGAGTGGCAGGAGGAT Chr7:87360556..87360575 60.26 55
downstream ENSMUSE00000200283 Chr7:87361215..87361326 GGACTTGAAGTTGGGGTCAA Chr7:87361313..87361332 59.94 50
downstream ENSMUSE00000317215 Chr7:87361616..87361729 CGTTTCCCTGGAAGCTACTG Chr7:87361663..87361682 59.87 55
downstream ENSMUSE00000317206 Chr7:87361834..87361985 GGACACGATGGTGTTCTCAA Chr7:87361967..87361986 59.53 50
downstream ENSMUSE00000200282 Chr7:87363769..87363950 GGGTTCAGGGTGAAGACATC Chr7:87363899..87363918 59.36 55
downstream ENSMUSE00000200267 Chr7:87364072..87364222 AGGCCTTCTGCACATCATTC Chr7:87364139..87364158 60.23 50
downstream ENSMUSE00000200266 Chr7:87365007..87365217 GCAGGGACGAGTTGATCTTC Chr7:87365055..87365074 59.81 55
downstream ENSMUSE00000200270 Chr7:87365328..87365443 CTCTGGAGCTCAGGGTCACT Chr7:87365372..87365391 59.58 60
downstream ENSMUSE00000200274 Chr7:87365674..87365840 GAATGGGAGGAGGCATACAA Chr7:87365702..87365721 59.89 50
downstream ENSMUSE00000672952 Chr7:87365674..87366718 GCCAGATCAGGCTGGTAGAG Chr7:87365837..87365856 59.97 60
downstream ENSMUSE00000317179 Chr7:87368820..87368902 AAGAAACCGGGCCTTGTATG Chr7:87368898..87368917 61.22 50
downstream ENSMUSE00000406768 Chr7:87369482..87371410 GATTCTCAACTTCGGCTTGC Chr7:87370599..87370618 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACAGGTAATCGCCTTGCAG Chr7:87331923..87331943 60.8 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGACGTAACTCCTTCCAG Chr7:87331859..87331879 60.1 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030539