Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10574
Trapped Gene
Scpep1 (ENSMUSG00000000278)
Vector Insertion
Chr 11: 88794876 - 88795891
Public Clones (sanger) (sanger) G023H08 (ggtc) E325C01 (ggtc) G079G06 (ggtc)
G004E01 (ggtc) G020C10 (ggtc) G003F06 (ggtc) IST11230B3 (tigm) IST11230B3 (tigm)
Private Clones OST373823 (lexicon) OST286030 (lexicon)
Severity of mutation (?) Insertion after 65% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000106544 (Chr11:88795892..88795985 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000106544 (Chr11:88795892..88795985 -)
Downstram Exon
ENSMUSE00000106539 (Chr11:88794762..88794875 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000402217 Chr11:88816608..88816743 No primer for this exon
upstream ENSMUSE00000106548 Chr11:88813720..88813868 No primer for this exon
upstream ENSMUSE00000264368 Chr11:88808459..88808548 No primer for this exon
upstream ENSMUSE00000106542 Chr11:88805689..88805844 No primer for this exon
upstream ENSMUSE00000264351 Chr11:88805111..88805185 No primer for this exon
upstream ENSMUSE00000264342 Chr11:88802598..88802670 No primer for this exon
upstream ENSMUSE00000264333 Chr11:88798328..88798365 No primer for this exon
upstream ENSMUSE00000264326 Chr11:88797137..88797265 No primer for this exon
upstream ENSMUSE00000106544 Chr11:88795892..88795985 No primer for this exon

*** Putative Vector Insertion (Chr 11: 88794876 - 88795891) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000106539 Chr11:88794762..88794875 No primer for this exon
downstream ENSMUSE00000106541 Chr11:88791522..88791659 No primer for this exon
downstream ENSMUSE00000106538 Chr11:88790479..88790642 No primer for this exon
downstream ENSMUSE00000403249 Chr11:88785336..88786038 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGAGAAAGCTATGGAATCG Chr11:88795918..88795938 59.8 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGGAGAAAGCTATGGAATCG Chr11:88795918..88795938 59.8 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AACACCGACGGGGTAAACTT Chr11:88795964..88795984 60.64 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AACACCGACGGGGTAAACTT Chr11:88795964..88795984 60.64 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000278