Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10592
Trapped Gene
P4ha1 (ENSMUSG00000019916)
Vector Insertion
Chr 10: 58818169 - 58824608
Public Clones P069D08 (ggtc) P069E07 (ggtc) P069G09 (ggtc)
Private Clones OST461449 (lexicon)
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000643358 (Chr10:58818098..58818168 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000643358 (Chr10:58818098..58818168 +)
Downstram Exon
ENSMUSE00000099095 (Chr10:58824609..58824708 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000576184 Chr10:58786116..58786224 No primer for this exon
upstream ENSMUSE00000099092 Chr10:58799802..58799904 No primer for this exon
upstream ENSMUSE00000099084 Chr10:58802044..58802140 No primer for this exon
upstream ENSMUSE00000099087 Chr10:58805432..58805583 No primer for this exon
upstream ENSMUSE00000099093 Chr10:58806405..58806542 No primer for this exon
upstream ENSMUSE00000099086 Chr10:58810929..58811168 No primer for this exon
upstream ENSMUSE00000099096 Chr10:58813152..58813348 No primer for this exon
upstream ENSMUSE00000099090 Chr10:58814831..58815007 No primer for this exon
upstream ENSMUSE00000349364 Chr10:58817088..58817158 No primer for this exon
upstream ENSMUSE00000643358 Chr10:58818098..58818168 No primer for this exon

*** Putative Vector Insertion (Chr 10: 58818169 - 58824608) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000099095 Chr10:58824609..58824708 No primer for this exon
downstream ENSMUSE00000099082 Chr10:58828037..58828090 No primer for this exon
downstream ENSMUSE00000099089 Chr10:58830037..58830102 No primer for this exon
downstream ENSMUSE00000099085 Chr10:58831989..58832057 No primer for this exon
downstream ENSMUSE00000483859 Chr10:58832335..58832431 No primer for this exon
downstream ENSMUSE00000497469 Chr10:58833752..58835684 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGCACTGGGCATAGTTGT Chr10:58821167..58821187 60.14 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGCACTGGGCATAGTTGT Chr10:58821167..58821187 60.14 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019916