Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10593
Trapped Gene
Golm1 (ENSMUSG00000021556)
Vector Insertion
Chr 13: 59765739 - 59766887
Public Clones G052E03 (ggtc) P073H01 (ggtc) P085B12 (ggtc) G085A02 (ggtc) P071A11 (ggtc)
P069G05 (ggtc) G075E07 (ggtc) P076F01 (ggtc) G050A02 (ggtc) P072E10 (ggtc)
(ggtc) G085C01 (ggtc) P084E06 (ggtc) G062C05 (ggtc) G066D12 (ggtc)
P083E02 (ggtc) G041F02 (ggtc) P071G06 (ggtc) P069F08 (ggtc) G081C05 (ggtc)
P085G05 (ggtc)
Private Clones OST260400 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000464771 (Chr13:59766888..59767037 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000464771 (Chr13:59766888..59767037 -)
Downstram Exon
ENSMUSE00000396671 (Chr13:59765559..59765738 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000614527 Chr13:59777088..59777145 No primer for this exon
upstream ENSMUSE00000614526 Chr13:59776322..59776457 No primer for this exon
upstream ENSMUSE00000464771 Chr13:59766888..59767037 No primer for this exon

*** Putative Vector Insertion (Chr 13: 59765739 - 59766887) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000396671 Chr13:59765559..59765738 No primer for this exon
downstream ENSMUSE00000118945 Chr13:59752057..59752111 No primer for this exon
downstream ENSMUSE00000118948 Chr13:59750924..59751026 No primer for this exon
downstream ENSMUSE00000118947 Chr13:59746454..59746583 No primer for this exon
downstream ENSMUSE00000118946 Chr13:59743604..59743748 No primer for this exon
downstream ENSMUSE00000118953 Chr13:59741481..59741702 No primer for this exon
downstream ENSMUSE00000118951 Chr13:59739666..59739773 No primer for this exon
downstream ENSMUSE00000413193 Chr13:59736357..59738762 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCGTGGAACTCCAGGTATGT Chr13:59766880..59766900 60 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCGTGGAACTCCAGGTATGT Chr13:59766880..59766900 60 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021556