Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10609
Trapped Gene
Golm1 (ENSMUSG00000021556)
Vector Insertion
Chr 13: 59751027 - 59752056
Public Clones P069B02 (ggtc) G031C04 (ggtc) M090E06 (ggtc) CMHD-GT_364G1-3 (cmhd)
Private Clones OST365258 (lexicon) OST230500 (lexicon) OST220642 (lexicon) OST198517 (lexicon)
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000118945 (Chr13:59752057..59752111 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000118945 (Chr13:59752057..59752111 -)
Downstram Exon
ENSMUSE00000118948 (Chr13:59750924..59751026 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000614527 Chr13:59777088..59777145 No primer for this exon
upstream ENSMUSE00000614526 Chr13:59776322..59776457 No primer for this exon
upstream ENSMUSE00000464771 Chr13:59766888..59767037 No primer for this exon
upstream ENSMUSE00000396671 Chr13:59765559..59765738 No primer for this exon
upstream ENSMUSE00000118945 Chr13:59752057..59752111 No primer for this exon

*** Putative Vector Insertion (Chr 13: 59751027 - 59752056) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000118948 Chr13:59750924..59751026 No primer for this exon
downstream ENSMUSE00000118947 Chr13:59746454..59746583 No primer for this exon
downstream ENSMUSE00000118946 Chr13:59743604..59743748 No primer for this exon
downstream ENSMUSE00000118953 Chr13:59741481..59741702 No primer for this exon
downstream ENSMUSE00000118951 Chr13:59739666..59739773 No primer for this exon
downstream ENSMUSE00000413193 Chr13:59736357..59738762 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGAGAAGCTCATTCGAGACC Chr13:59752061..59752081 60.1 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGAGAAGCTCATTCGAGACC Chr13:59752061..59752081 60.1 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021556